Pedido rápido

Humano MST4/MST-4 clonación del ADN o clonación génica(vector de clonación)

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano MST4 Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_016542.3
    Tamaño de cDNA:1251bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens serine/threonine protein kinase MST4.
    Sinónimo de gen:MST4, MASK
    Especie:Human
    Vector:pCMV3-untagged
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MST4 qPCR primers for gene expression analysis, HP100634 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Humano MST4/MST-4 clonación del ADN o clonación génica(vector de clonación) on other vectors
    Humano MST4/MST-4 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10667-ACG$225
    Humano MST4/MST-4 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10667-ACR$225
    Humano MST4/MST-4 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10667-ANG$225
    Humano MST4/MST-4 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10667-ANR$225
    Humano MST4/MST-4 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10667-CF$195
    Humano MST4/MST-4 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10667-CH$195
    Humano MST4/MST-4 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10667-CM$195
    Humano MST4/MST-4 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10667-CY$195
    Humano MST4/MST-4 clonación del ADN o clonación génica(Vector de expresión)HG10667-M$75
    Humano MST4/MST-4 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10667-M-F$195
    Humano MST4/MST-4 clonación del ADN o clonación génica(vector de clonación)HG10667-M-N$195
    Humano MST4/MST-4 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10667-NF$195
    Humano MST4/MST-4 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10667-NH$195
    Humano MST4/MST-4 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10667-NM$195
    Humano MST4/MST-4 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10667-NY$195
    Humano MST4/MST-4 clonación del ADN o clonación génica(vector de clonación)HG10667-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    MST4, also known as mammalian STE20-like protein kinase 4, is a novel member of the germinal center kinase subfamily of human Ste20-like kinases and is closely related to MST3. The 416 amino acid full-length MST4 contains a C-terminal regulatory domain and an N-terminal kinase domain, both of which are required for full activation of the kinase. MST4 is highly expressed in placenta, thymus, and peripheral blood leukocytes. MST4 specifically activates ERK but not JNK or p38 MAPK in transient transfected cells or in stable cell lines, and thus is biologically active in the activation of MEK/ERK pathway mediating cell growth and transformation. Further, MST4 kinase activity is stimulated significantly by epidermal growth factor receptor (EGFR) ligands, which are known to promote growth of certain cancer cells. Accordingly, MST4 have a potential role in signal transduction pathways involved in cancer progression. Three alternatively spliced isoform of MST4 have been isolated, and isoform 3 lacks an exon encoding kinase domain and may function as a dominant-negative regulator of the MST4 kinase.

    Referencias

    1. Qian, Z. et al., 2001, J Biol Chem. 276 :22439-45.

    2. Lin, JL. et al., 2001, Oncogene. 20: 6559-6569.

    3. Sung V, et al., 2003, Cancer research. 63: 3356-63.

    4. Ma, X. et al., 2007, Molecular biology of the cell. 18:1965-78.

    5. ten Klooster JP, et al., 2009, Developmental cell. 16:551-62.

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"