After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano MTMR12 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human MTMR12 Información de producto de clon de cDNA
Gene_bank_ref_id:BC057393
Tamaño de cDNA:2082bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens myotubularin related protein 12 DNA.
Sinónimo de gen:3-PAP, PIP3AP
Especie:Human
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano MTMR12 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano MTMR12 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG15209-ACG$245
Humano MTMR12 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG15209-ACR$245
Humano MTMR12 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG15209-ANG$245
Humano MTMR12 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG15209-ANR$245
Humano MTMR12 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG15209-CF$215
Humano MTMR12 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG15209-CH$215
Humano MTMR12 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG15209-CM$215
Humano MTMR12 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG15209-CY$215
Humano MTMR12 clonación del ADN o clonación génica(Vector de expresión)HG15209-G$75
Humano MTMR12 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG15209-NF$215
Humano MTMR12 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG15209-NH$215
Humano MTMR12 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG15209-NM$215
Humano MTMR12 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG15209-NY$215
Humano MTMR12 clonación del ADN o clonación génica(vector de clonación)HG15209-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG15209-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"