NBR1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG15050-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All NBR1 Reagents
CRO Services
Product recommended

All NBR1 Reagents
NBR1 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2814 bp
Description
Full length Clone DNA of Human neighbor of BRCA1 gene 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NBR1 cDNA ORF Clone, Human, N-Myc tag Alternative Names
1A1-3B cDNA ORF Clone, Human;IAI3B cDNA ORF Clone, Human;M17S2 cDNA ORF Clone, Human;MIG19 cDNA ORF Clone, Human
NBR1 Background Information
Full Name
neighbor of BRCA1 gene 1

NBR1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NBR1 cDNA ORF Clone in Cloning Vector, Mouse MG53947-U
NBR1 cDNA ORF Clone, Mouse, untagged MG53947-UT
NBR1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53947-ACGLN
NBR1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53947-ACG
NBR1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53947-ANG
NBR1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53947-ACR
NBR1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53947-ANR
NBR1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53947-CF
NBR1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53947-NF
NBR1 cDNA ORF Clone, Mouse, C-His tag MG53947-CH
NBR1 cDNA ORF Clone, Mouse, N-His tag MG53947-NH
NBR1 cDNA ORF Clone, Mouse, C-HA tag MG53947-CY
NBR1 cDNA ORF Clone, Mouse, N-HA tag MG53947-NY
NBR1 cDNA ORF Clone, Mouse, C-Myc tag MG53947-CM
NBR1 cDNA ORF Clone, Mouse, N-Myc tag MG53947-NM

NBR1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NBR1 cDNA ORF Clone in Cloning Vector, Human HG15050-G
NBR1 cDNA ORF Clone, Human, untagged HG15050-UT
NBR1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15050-ACGLN
NBR1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15050-ACG
NBR1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15050-ANG
NBR1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15050-ACR
NBR1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15050-ANR
NBR1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15050-CF
NBR1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15050-NF
NBR1 cDNA ORF Clone, Human, C-His tag HG15050-CH
NBR1 cDNA ORF Clone, Human, N-His tag HG15050-NH
NBR1 cDNA ORF Clone, Human, C-HA tag HG15050-CY
NBR1 cDNA ORF Clone, Human, N-HA tag HG15050-NY
NBR1 cDNA ORF Clone, Human, C-Myc tag HG15050-CM
NBR1 qPCR Primer Pairs, Human HP103678
info info
添加购物车成功! 添加购物车失败!