After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano NCAM1 / CD56 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human NCAM1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001076682.2
Tamaño de cDNA:2286bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens neural cell adhesion molecule 1.
Sinónimo de gen:CD56, NCAM, MSK39, NCAM1
Especie:Human
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano NCAM1 / CD56 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano NCAM1 / CD56 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10673-ACG$245
Humano NCAM1 / CD56 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10673-ACR$245
Humano NCAM1 / CD56 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10673-CF$215
Humano NCAM1 / CD56 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10673-CH$215
Humano NCAM1 / CD56 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10673-CM$215
Humano NCAM1 / CD56 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10673-CY$215
Humano NCAM1 / CD56 clonación del ADN o clonación génica(Vector de expresión)HG10673-M$75
Humano NCAM1 / CD56 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10673-M-F$215
Humano NCAM1 / CD56 clonación del ADN o clonación génica(vector de clonación)HG10673-M-N$215
Humano NCAM1 / CD56 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10673-NF$215
Humano NCAM1 / CD56 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10673-NH$215
Humano NCAM1 / CD56 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10673-NM$215
Humano NCAM1 / CD56 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10673-NY$215
Humano NCAM1 / CD56 clonación del ADN o clonación génica(vector de clonación)HG10673-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

NCAM1, also known as CD56, is a neural adhesion protein (NCAM) which belongs to the immunoglobulin superfamily. NCAM is involved in neural development and in plasticity in the adult brain. UCHL1 is a novel interaction partner of both NCAM isoforms that regulates their ubiquitination and intracellular trafficking. NCAM1 is a cell adhesion molecule involved in neuron-neuron adhesion, neurite fasciculation, outgrowth of neurites, etc. NCAM1 has also been shown to be involved in the expansion of T cells and dendritic cells which play an important role in immune surveillance.

Referencias
  • Reyes AA. et al., 1991, Mol Cell Biol. 11 (3): 1654-61.
  • Suzuki M. et al., 2003, J Biol Chem. 278 (49): 49459-68.
  • Becker C G. et al., 1996, J Neurosci Res. 45 (2): 143-52.
  • Size / Price
    Catálogo: HG10673-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"