Pedido rápido

Humano B7-H6/B7H6 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human NCR3LG1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001202439.2
Tamaño de cDNA:1365bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens natural killer cell cytotoxicity receptor 3 ligand 1.
Sinónimo de gen:B7H6, B7-H6, DKFZp686O24166
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-NCR3LG1
Sitio de restricción:KpnI + XbaI (6.1kb + 1.37kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human NCR3LG1 Gene Plasmid Map
Human NCR3LG1 natural ORF mammalian expression plasmid
Product nameProduct name
Size / Price
Catálogo: HG16140-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
DisponibilidadIn Stock
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
  • Human NCR3LG1 natural ORF mammalian expression plasmid
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"