After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano NDUFS8 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human NDUFS8 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_002496.3
Tamaño de cDNA:633bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase) with C terminal His tag.
Sinónimo de gen:TYKY, CI-23k, CI23KD
Especie:Human
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano NDUFS8 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano NDUFS8 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG16338-ACG$225
Humano NDUFS8 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG16338-ACR$225
Humano NDUFS8 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG16338-ANG$225
Humano NDUFS8 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG16338-ANR$225
Humano NDUFS8 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG16338-CF$195
Humano NDUFS8 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG16338-CH$195
Humano NDUFS8 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG16338-CM$195
Humano NDUFS8 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG16338-CY$195
Humano NDUFS8 clonación del ADN o clonación génica(Vector de expresión)HG16338-G$75
Humano NDUFS8 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG16338-NF$195
Humano NDUFS8 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG16338-NH$195
Humano NDUFS8 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG16338-NM$195
Humano NDUFS8 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG16338-NY$195
Humano NDUFS8 clonación del ADN o clonación génica(vector de clonación)HG16338-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG16338-CH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"