After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano NEGR1 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human NEGR1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_173808.2
Tamaño de cDNA:1065bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens neuronal growth regulator 1.
Sinónimo de gen:Ntra, KILON, IGLON4, DMML2433, MGC46680, NEGR1
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-NEGR1
Sitio de restricción:HindIII + XbaI (6.1kb + 1.07kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence except for the point mutation 888C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Fondo

Neuronal Growth Regulator 1, NEGR1, also known as neurotractin, or KILON, which belongs to the immunoglobulin superfamily, IgLON family. This GPI-linked cell surface glycoprotein NEGR1 is composed of three Ig-like domains and belongs to the IgLON subgroup of neural IgSF members. It is expressed in two isoforms with apparent molecular masses of 50 and 37 kD, termed L-form and S-form, respectively. NEGR1/Neurotractin participates in the regulation of neurite outgrowth in the developing brain, and is expressed on neurites of primary hippocampal neurons. Neurotractin/KILON is a trans-neural growth-promoting factor for outgrowing axons following hippocampal denervation. KILON (kindred of IgLON) and opioid-binding cell adhesion molecule belong to the IgLON subgroup of immunoglobulin superfamily together with the limbic system-associated membrane protein and neurotrimin. The alteration of modulatory function of KILON/NEGR1 for the number of dendritic synapses concomitant with changes in its localization and detergent solubility during neuronal culture development. In addition to its reported role in the brain, NEGR1 is also expressed in subcutaneous adipose tissue and acts as a central 'hub' in an obesity-related transcript network.

Referencias
  • Marg A, et al. (1999) Neurotractin, a novel neurite outgrowth-promoting Ig-like protein that interacts with CEPU-1 and LAMP. J Cell Biol. 145(4): 865-76.
  • Miyata S, et al. (2003) Biochemical and ultrastructural analyses of IgLON cell adhesion molecules, Kilon and OBCAM in the rat brain. Neuroscience. 117(3): 645-58.
  • Schfer M, et al. (2005) Neurotractin/kilon promotes neurite outgrowth and is expressed on reactive astrocytes after entorhinal cortex lesion. Mol Cell Neurosci. 29(4): 580-90.
  • Hashimoto T, et al. (2008) IgLON cell adhesion molecule Kilon is a crucial modulator for synapse number in hippocampal neurons. Brain Res. 1224: 1-11.
  • Size / Price
    Catálogo: HG11181-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"