After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano NEK3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human NEK3 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_152720.1
Tamaño de cDNA:1521bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens NIMA (never in mitosis gene a)-related kinase 3, transcript variant 2.
Sinónimo de gen:HSPK36, MGC29949, NEK3
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-NEK3
Sitio de restricción:KpnI + XbaI (6.1kb + 1.52kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence except for the point mutation 1236T/G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human NEK3 Gene Plasmid Map
Human NEK3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano NEK3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano NEK3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10675-ACG$245
Humano NEK3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10675-ACR$245
Humano NEK3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10675-ANG$245
Humano NEK3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10675-ANR$245
Humano NEK3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10675-CF$215
Humano NEK3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10675-CH$215
Humano NEK3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10675-CM$215
Humano NEK3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10675-CY$215
Humano NEK3 transcript variant 2 clonación del ADN o clonación génica(Vector de expresión)HG10675-M$75
Humano NEK3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10675-M-F$215
Humano NEK3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10675-NF$215
Humano NEK3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10675-NH$215
Humano NEK3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10675-NM$215
Humano NEK3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10675-NY$215
Humano NEK3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación)HG10675-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

NEK3 (NIMA (never in mitosis gene a)-related expressed kinase 3), contains 1 protein kinase domain and is a member of the NimA (never in mitosis A) family of serine/threonine protein kinases. Members of the NEK family of protein kinases share high amino acid homology with NIMA (never in mitosis gene a). NEK3 differs from other NimA family members in that it is not cell cycle regulated and is found primarily in the cytoplasm. It is activated by prolactin stimulation, leading to phosphorylation of VAV2 guanine nucleotide exchange factor, paxillin, and activation of the RAC1 GTPase. NEK3 mRNA can be detected in all the proliferating cell lines with the amount not changing during the cell cycle. Prolactin stimulates interaction between NEK3 and paxillin leading to increased paxillin phosphorylation, Analysis of breast tissue microarrays show a significant up-regulation of NEK3 expression in malignant versus normal specimens. Multiple transcript variants encoding different isoforms have been found for NEK3 gene. NEK3 may play a role in mitotic regulation.

Referencias
  • Miller SL, et al. (2007) Nek3 kinase regulates prolactin-mediated cytoskeletal reorganization and motility of breast cancer cells. Oncogene. 26(32):4668-78.
  • Hernandez M, et al. (2006) Is there any association between nek3 and cancers with frequent 13q14 deletion?. Cancer Invest. 24(7):682-8.
  • Tanaka K, et al. (1999) Cloning and characterization of the murine Nek3 protein kinase, a novel member of the NIMA family of putative cell cycle regulators. J Biol Chem. 274(19):13491-7.
  • Size / Price
    Catálogo: HG10675-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
    • Human NEK3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"