Pedido rápido

Humano NEK8 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human NEK8 Información de producto de clon de cDNA
Tamaño de cDNA:2079bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens NIMA (never in mitosis gene a)- related kinase 8 with C terminal His tag.
Sinónimo de gen:JCK, NEK12A, MGC138445,
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano NEK8 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano NEK8 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11122-ACG$245
Humano NEK8 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11122-ACR$245
Humano NEK8 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11122-ANG$245
Humano NEK8 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11122-ANR$245
Humano NEK8 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11122-CF$215
Humano NEK8 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11122-CH$215
Humano NEK8 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11122-CM$215
Humano NEK8 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11122-CY$215
Humano NEK8 clonación del ADN o clonación génica(Vector de expresión)HG11122-M$75
Humano NEK8 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11122-M-F$215
Humano NEK8 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11122-NF$215
Humano NEK8 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11122-NH$215
Humano NEK8 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11122-NM$215
Humano NEK8 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11122-NY$215
Humano NEK8 clonación del ADN o clonación génica(vector de clonación)HG11122-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG11122-CH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.