After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano NFE2L1/Nrf1 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human NFE2L1 Información de producto de clon de cDNA
Gene_bank_ref_id:BC010623
Tamaño de cDNA:2229bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens nuclear factor (erythroid-derived 2)-like 1.
Sinónimo de gen:FLJ00380, LCR-F1, NRF1, TCF11, NFE2L1
Especie:Human
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano NFE2L1/Nrf1 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano NFE2L1/Nrf1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14221-ACG$245
Humano NFE2L1/Nrf1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14221-ACR$245
Humano NFE2L1/Nrf1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14221-ANG$245
Humano NFE2L1/Nrf1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14221-ANR$245
Humano NFE2L1/Nrf1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14221-CF$215
Humano NFE2L1/Nrf1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14221-CH$215
Humano NFE2L1/Nrf1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14221-CM$215
Humano NFE2L1/Nrf1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14221-CY$215
Humano NFE2L1/Nrf1 clonación del ADN o clonación génica(Vector de expresión)HG14221-G$75
Humano NFE2L1/Nrf1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14221-NF$215
Humano NFE2L1/Nrf1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14221-NH$215
Humano NFE2L1/Nrf1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14221-NM$215
Humano NFE2L1/Nrf1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14221-NY$215
Humano NFE2L1/Nrf1 clonación del ADN o clonación génica(vector de clonación)HG14221-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG14221-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"