Pedido rápido

Humano Neuroligin 3 / NLGN3 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano NLGN3 Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_018977.2
    Tamaño de cDNA:2487bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens neuroligin 3 with N terminal HA tag.
    Sinónimo de gen:HNL3, ASPGX1, AUTSX1, KIAA1480, NLGN3
    Especie:Human
    Vector:pCMV3-SP-N-HA
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with NLGN3 qPCR primers for gene expression analysis, HP101068 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Humano Neuroligin 3 / NLGN3 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta on other vectors
    Humano Neuroligin 3 / NLGN3 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11160-ACG$245
    Humano Neuroligin 3 / NLGN3 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11160-ACR$245
    Humano Neuroligin 3 / NLGN3 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11160-CF$215
    Humano Neuroligin 3 / NLGN3 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11160-CH$215
    Humano Neuroligin 3 / NLGN3 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11160-CM$215
    Humano Neuroligin 3 / NLGN3 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11160-CY$215
    Humano Neuroligin 3 / NLGN3 clonación del ADN o clonación génica(Vector de expresión)HG11160-M$75
    Humano Neuroligin 3 / NLGN3 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11160-M-F$215
    Humano Neuroligin 3 / NLGN3 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11160-NF$215
    Humano Neuroligin 3 / NLGN3 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11160-NH$215
    Humano Neuroligin 3 / NLGN3 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11160-NM$215
    Humano Neuroligin 3 / NLGN3 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11160-NY$215
    Humano Neuroligin 3 / NLGN3 clonación del ADN o clonación génica(vector de clonación)HG11160-UT$215
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    Neuroligin 3 (NLGN3) is a member of the type-B carboxylesterase/lipase family. Neuroligins (NLGNs) are a family of presumptive postsynaptic cell adhesion molecules. Neuroligins (NLs) constitute a family of cell-surface proteins that interact with neurexins (beta-Nxs), another class of neuronal cell-surface proteins, one of each class functioning together in synapse formation. Neuroligins control the formation and functional balance of excitatory and inhibitory synapses in hippocampal neurons. NLGN1 and NLGN2 isoforms are concentrated at glutamatergic and GABAergic synapses, respectively, but the cellular expression and synaptic localization of the endogenous. NLGN3 was enriched in brain, where NLGN3 protein levels increased during postnatal development, coinciding with the peak of synaptogenesis. The NLGN3 is a synaptic adhesion molecule that is a shared component of glutamatergic and GABAergic synapses. Mutations in NLGN3 gene may be associated with autism and Asperger syndrome.

    Referencias
  • Chih B, et al. (2005) Control of excitatory and inhibitory synapse formation by neuroligins. Science. 307(5713): 1324-8.
  • Paraoanu LE, et al. (2006) Expression patterns of neurexin-1 and neuroligins in brain and retina of the chick embryo: Neuroligin-3 is absent in retina. Neurosci Lett. 395(2): 114-7.
  • Budreck EC, et al. (2007) Neuroligin-3 is a neuronal adhesion protein at GABAergic and glutamatergic synapses. Eur J Neurosci. 26(7): 1738-48.
  • Size / Price
    Catálogo: HG11160-NY
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"