After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano NPM1/Nucleophosmin transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human NPM1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_002520
Tamaño de cDNA:885bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens nucleophosmin (nucleolar phosphoprotein B23, numatrin) with N terminal Flag tag.
Sinónimo de gen:B23, NPM
Especie:Human
Vector:pCMV3-N-FLAG
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano NPM1/Nucleophosmin transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Humano NPM1/Nucleophosmin transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG12074-ACG$225
Humano NPM1/Nucleophosmin transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG12074-ACR$225
Humano NPM1/Nucleophosmin transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG12074-ANG$225
Humano NPM1/Nucleophosmin transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG12074-ANR$225
Humano NPM1/Nucleophosmin transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG12074-CF$195
Humano NPM1/Nucleophosmin transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG12074-CH$195
Humano NPM1/Nucleophosmin transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG12074-CM$195
Humano NPM1/Nucleophosmin transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG12074-CY$195
Humano NPM1/Nucleophosmin transcript variant 1 clonación del ADN o clonación génica(Vector de expresión)HG12074-G$75
Humano NPM1/Nucleophosmin transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG12074-NF$195
Humano NPM1/Nucleophosmin transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG12074-NH$195
Humano NPM1/Nucleophosmin transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG12074-NM$195
Humano NPM1/Nucleophosmin transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG12074-NY$195
Humano NPM1/Nucleophosmin transcript variant 1 clonación del ADN o clonación génica(vector de clonación)HG12074-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Nucleophosmin 1 (NPM1), also known as nucleolar phosphoprotein B23 or numatrin, is a member of the nucleoplasmin family. Nucleophosmin (NPM) is a nucleolar phosphoprotein that plays multiple roles in ribosome assembly and transport, cytoplasmic-nuclear trafficking, centrosome duplication and regulation of p53. The NPM1 gene is frequently involved in chromosomal translocation, mutation and deletion. Mutations of the NPM1 gene leading to the expression of a cytoplasmic mutant protein, NPMc+, are the most frequent genetic abnormalities found in acute myeloid leukemias. Acute myeloid leukemias (AML) with mutated NPM1 have distinct characteristics, including a significant association with a normal karyotype, involvement of different hematopoietic lineages, a specific gene-expression profile and clinically, a better response to induction therapy and a favorable prognosis. In addition, NPM1 is a crucial gene to consider in the context of the genetics and biology of cancer. NPM1 is frequently overexpressed, mutated, rearranged and deleted in human cancer. Traditionally regarded as a tumour marker and a putative proto-oncogene, it has now also been attributed with tumour-suppressor functions.

Referencias
  • Chen W, et al. (2006) Nucleophosmin gene mutations in acute myeloid leukemia. Arch Pathol Lab Med. 130(11): 1687-92.
  • Naoe T, et al. (2006) Nucleophosmin: a versatile molecule associated with hematological malignancies. Cancer Sci. 97(10): 963-9.
  • Grisendi S, et al. (2006) Nucleophosmin and cancer. Nat Rev Cancer. 6(7): 493-505.
  • Falini B, et al. (2007) Acute myeloid leukemia carrying cytoplasmic/mutated nucleophosmin (NPMc+ AML): biologic and clinical features. Blood. 109(3): 874-85.
  • Meani N, et al. (2009) Role of nucleophosmin in acute myeloid leukemia. Expert Rev Anticancer Ther. 9(9): 1283-94.
  • Size / Price
    Catálogo: HG12074-NF
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"