NPTXR cDNA ORF Clone, Human, N-Myc tag

Cat: HG16070-NM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All NPTXR Reagents

CRO Services

Product recommended


All NPTXR Reagents

NPTXR cDNA ORF Clone, Human, N-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1503 bp
Description
Full length Clone DNA of Human neuronal pentraxin receptor with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NPTXR cDNA ORF Clone, Human, N-Myc tag Alternative Names

NPR cDNA ORF Clone, Human

NPTXR Background Information

Full Name
neuronal pentraxin receptor

NPTXR cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
NPTXR cDNA ORF Clone in Cloning Vector, Cynomolgus CG90819-G
NPTXR cDNA ORF Clone, Cynomolgus, untagged CG90819-UT
NPTXR Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90819-ACGLN
NPTXR cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90819-ACG
NPTXR cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90819-ACR
NPTXR cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90819-CF
NPTXR cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90819-NF
NPTXR cDNA ORF Clone, Cynomolgus, C-His tag CG90819-CH
NPTXR cDNA ORF Clone, Cynomolgus, N-His tag CG90819-NH
NPTXR cDNA ORF Clone, Cynomolgus, C-HA tag CG90819-CY
NPTXR cDNA ORF Clone, Cynomolgus, N-HA tag CG90819-NY
NPTXR cDNA ORF Clone, Cynomolgus, C-Myc tag CG90819-CM
NPTXR cDNA ORF Clone, Cynomolgus, N-Myc tag CG90819-NM

NPTXR cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
NPTXR cDNA ORF Clone in Cloning Vector, Rhesus CG90716-G
NPTXR cDNA ORF Clone, Rhesus, untagged CG90716-UT
NPTXR Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90716-ACGLN
NPTXR cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90716-ACG
NPTXR cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90716-ANG
NPTXR cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90716-ACR
NPTXR cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90716-ANR
NPTXR cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90716-CF
NPTXR cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90716-NF
NPTXR cDNA ORF Clone, Rhesus, C-His tag CG90716-CH
NPTXR cDNA ORF Clone, Rhesus, N-His tag CG90716-NH
NPTXR cDNA ORF Clone, Rhesus, C-HA tag CG90716-CY
NPTXR cDNA ORF Clone, Rhesus, N-HA tag CG90716-NY
NPTXR cDNA ORF Clone, Rhesus, C-Myc tag CG90716-CM
NPTXR cDNA ORF Clone, Rhesus, N-Myc tag CG90716-NM

NPTXR cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NPTXR cDNA ORF Clone in Cloning Vector, Human HG16070-G
NPTXR cDNA ORF Clone, Human, untagged HG16070-UT
NPTXR Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16070-ACGLN
NPTXR cDNA ORF Clone, Human, C-GFPSpark® tag HG16070-ACG
NPTXR cDNA ORF Clone, Human, C-OFPSpark® tag HG16070-ACR
NPTXR cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16070-CF
NPTXR cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16070-NF
NPTXR cDNA ORF Clone, Human, C-His tag HG16070-CH
NPTXR cDNA ORF Clone, Human, N-His tag HG16070-NH
NPTXR cDNA ORF Clone, Human, C-HA tag HG16070-CY
NPTXR cDNA ORF Clone, Human, N-HA tag HG16070-NY
NPTXR cDNA ORF Clone, Human, C-Myc tag HG16070-CM
info info
添加购物车成功! 添加购物车失败!