Pedido rápido

Text Size:AAA

Humano NRG4 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human NRG4 Información de producto de clon de cDNA
Tamaño de cDNA:348bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens neuregulin 4 with C terminal Myc tag.
Sinónimo de gen:HRG4, NRG4
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

NRG4 (neuregulin 4) is a member of the neuregulin protein family. The neuregulins consist of four structurally-related proteins that are part of the EGF family of proteins. It has been shown that these proteins have diverse functions in the development of the nervous system and play multiple essential roles in vertebrate embryogenesis including: cardiac development, Schwann cell and oligodendrocyte differentiation, some aspects of neuronal development, as well as the formation of neuromuscular synapses. NRG4 contains 1 EGF-like domain. It activates type-1 growth factor receptors to initiating cell-to-cell signaling through tyrosine phosphorylation. NRG4 is a low affinity ligand for the ERBB4 tyrosine kinase receptor. It concomitantly recruits ERBB1 and ERBB2 coreceptors, resulting in ligand-stimulated tyrosine phosphorylation and activation of the ERBB receptors. However, it does not bind to the ERBB1, ERBB2 and ERBB3 receptors.

  • Strausberg RL, et al. (2002) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Nat Acad Sci. 99(26):16899-903.
  • Harari D, et al. (1999) Neuregulin-4: a novel growth factor that acts through the ErbB-4 receptor tyrosine kinase. Oncogene. 18(17):2681-9.
  • Memon AA, et al. (2004) Expression of HER3, HER4 and their ligand heregulin-4 is associated with better survival in bladder cancer patients. Br J Cancer. 91(12) 2034-41.
  • Size / Price
    Catálogo: HG12183-CM
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.