After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano OAT/ornithine aminotransferase clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human OAT Información de producto de clon de cDNA
Gene_bank_ref_id:NM_000274.3
Tamaño de cDNA:1320bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens ornithine aminotransferase.
Sinónimo de gen:OKT, GACR, HOGA, OATASE
Especie:Human
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano OAT/ornithine aminotransferase clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano OAT/ornithine aminotransferase clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG16152-ACG$225
Humano OAT/ornithine aminotransferase clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG16152-ACR$225
Humano OAT/ornithine aminotransferase clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG16152-ANG$225
Humano OAT/ornithine aminotransferase clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG16152-ANR$225
Humano OAT/ornithine aminotransferase clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG16152-CF$195
Humano OAT/ornithine aminotransferase clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG16152-CH$195
Humano OAT/ornithine aminotransferase clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG16152-CM$195
Humano OAT/ornithine aminotransferase clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG16152-CY$195
Humano OAT/ornithine aminotransferase clonación del ADN o clonación génica(Vector de expresión)HG16152-G$75
Humano OAT/ornithine aminotransferase clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG16152-NF$195
Humano OAT/ornithine aminotransferase clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG16152-NH$195
Humano OAT/ornithine aminotransferase clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG16152-NM$195
Humano OAT/ornithine aminotransferase clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG16152-NY$195
Humano OAT/ornithine aminotransferase clonación del ADN o clonación génica(vector de clonación)HG16152-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG16152-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"