Optineurin cDNA ORF Clone, Human, N-HA tag

1/1
Price:
Size:
Number:

Optineurin cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1776 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 102A/G not causing the amino acid variation.
Description
Full length Clone DNA of Human optineurin with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+1.78kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Optineurin cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Optineurin cDNA ORF Clone, Human, N-HA tag: Validated Images

Optineurin cDNA ORF Clone, Human, N-HA tag: Alternative Names

ALS12 cDNA ORF Clone, Human; FIP2 cDNA ORF Clone, Human; GLC1E cDNA ORF Clone, Human; HIP7 cDNA ORF Clone, Human; HYPL cDNA ORF Clone, Human; NRP cDNA ORF Clone, Human; TFIIIA-INTP cDNA ORF Clone, Human

Optineurin Background Information

Optineurin gene encodes the coiled-coil containing protein optineurin. Optineurin may play a role in normal-tension glaucoma and adult-onset primary open angle glaucoma. Optineurin interacts with adenovirus E3-14.7K protein and may utilize tumor necrosis factor-alpha or Fas-ligand pathways to mediate apoptosis, inflammation or vasoconstriction. Optineurin may also function in cellular morphogenesis and membrane trafficking, vesicle trafficking, and transcription activation through its interactions with the RAB8, huntingtin, and transcription factor IIIA proteins. Alternative splicing results in multiple transcript variants encoding the same protein.
Full Name
optineurin
References
  • Rezaie T. et al., 2002, Science. 295 (5557): 1077-9.
  • Li Y. et al., 1998, Mol Cell Biol. 18 (3): 1601-10.
  • Skarnes Wc RB. et al., 2011, Nature. 474 (7351): 337-42.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait