Pedido rápido

Humano OSMR/IL-31RB transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human OSMR Información de producto de clon de cDNA
Tamaño de cDNA:2940bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens oncostatin M receptor1 with N terminal Flag tag.
Sinónimo de gen:OSMRB, MGC75127, MGC150626, MGC150627,
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano OSMR/IL-31RB transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Humano OSMR/IL-31RB transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11226-ACG$325
Humano OSMR/IL-31RB transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11226-ACR$325
Humano OSMR/IL-31RB transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11226-CF$295
Humano OSMR/IL-31RB transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11226-CH$295
Humano OSMR/IL-31RB transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11226-CM$295
Humano OSMR/IL-31RB transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11226-CY$295
Humano OSMR/IL-31RB transcript variant 1 clonación del ADN o clonación génica(Vector de expresión)HG11226-M$75
Humano OSMR/IL-31RB transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11226-NF$295
Humano OSMR/IL-31RB transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11226-NH$295
Humano OSMR/IL-31RB transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11226-NM$295
Humano OSMR/IL-31RB transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11226-NY$295
Humano OSMR/IL-31RB transcript variant 1 clonación del ADN o clonación génica(vector de clonación)HG11226-UT$295
 Más información sobre los vectores de expresión
Product nameProduct name

Oncostatin-M specific receptor subunit beta also known as the oncostatin M receptor (OSMR) and Interleukin-31 receptor subunit beta (IL-31RB), is one of the receptor proteins for oncostatin M. OSMR is a member of the type I cytokine receptor family. IL-31RB/OSMR heterodimerizes with interleukin 6 signal transducer to form the type II oncostatin M receptor and with interleukin 31 receptor A to form the interleukin 31 receptor, and thus transduces oncostatin M and interleukin 31 induced signaling events. Mutations in IL-31RB/OSMR have been associated with familial primary localized cutaneous amyloidosis. Defects in IL-31RB/OSMR are the cause of amyloidosis primary localized cutaneous type 1 (PLCA1), also known as familial lichen amyloidosis or familial cutaneous lichen amyloidosis. PLCA1 is a hereditary primary amyloidosis characterized by localized cutaneous amyloid deposition. This condition usually presents with itching (especially on the lower legs) and visible changes of skin hyperpigmentation and thickening (lichenification) that may be exacerbated by chronic scratching and rubbing. The amyloid deposits probably reflect a combination of degenerate keratin filaments, serum amyloid P component, and deposition of immunoglobulins.

  • Arita K, et al.. (2008) Oncostatin M Receptor-β Mutations Underlie Familial Primary Localized Cutaneous Amyloidosis. Am J Hum. Genet. 82 (1): 73-80.
  • Malaval L, et al.. (2005) GP130/OSMR is the only LIF/IL-6 family receptor complex to promote osteoblast differentiation of calvaria progenitors. J Cell Physiol. 204(2): 585-93.
  • Lin MW, et al.. (2010) Novel IL31RA gene mutation and ancestral OSMR mutant allele in familial primary cutaneous amyloidosis. Eur J Hum Genet. 18(1): 26-32.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.