Pedido rápido

Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación)

  • Human PARP3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Hoja de datosReseñasProductos relacionadosProtocolos
Humano PARP3 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_005485.4
Tamaño de cDNA:1602bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens poly (ADP-ribose) polymerase family, member 3, transcript variant 2.
Sinónimo de gen:IRT1, ADPRT3, ADPRTL2, ADPRTL3, PADPRT-3, PARP3
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-PARP3
Sitio de restricción:KpnI + XbaI (6.1kb + 1.6kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with PARP3 qPCR primers for gene expression analysis, HP101095 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano PARP3 Gene Plasmid Map
Human PARP3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11190-ACG$245
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11190-ACR$245
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11190-ANG$245
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11190-ANR$245
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11190-CF$215
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11190-CH$215
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11190-CM$215
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11190-CY$215
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(Vector de expresión)HG11190-M$75
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11190-M-F$215
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11190-NF$215
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11190-NH$215
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11190-NM$215
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11190-NY$215
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación)HG11190-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Referencias
  • Loseva O, et al. (2010) PARP-3 is a mono-ADP-ribosylase that activates PARP-1 in the absence of DNA. J Biol Chem. 285(11): 8054-60.
  • Lehtio L, et al. (2009) Structural basis for inhibitor specificity in human poly(ADP-ribose) polymerase-3. J Med Chem. 52(9): 3108-11.
  • Rouleau M, et al. (2009) Assessment of PARP-3 distribution in tissues of cynomolgous monkeys. J Histochem Cytochem. 57(7): 675-85.
  • Rouleau M, et al. (2007) PARP-3 associates with polycomb group bodies and with components of the DNA damage repair machinery. J Cell Biochem. 100(2): 385-401.
  • Augustin A, et al. (2003) PARP-3 localizes preferentially to the daughter centriole and interferes with the G1/S cell cycle progression. J Cell Sci. 116(Pt 8): 1551-62.
  • Size / Price
    Catálogo: HG11190-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"