After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human PARP3 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_005485.4
Tamaño de cDNA:1602bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens poly (ADP-ribose) polymerase family, member 3, transcript variant 2.
Sinónimo de gen:IRT1, ADPRT3, ADPRTL2, ADPRTL3, PADPRT-3, PARP3
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-PARP3
Sitio de restricción:KpnI + XbaI (6.1kb + 1.6kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human PARP3 Gene Plasmid Map
Human PARP3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11190-ACG$245
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11190-ACR$245
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11190-ANG$245
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11190-ANR$245
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11190-CF$215
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11190-CH$215
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11190-CM$215
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11190-CY$215
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(Vector de expresión)HG11190-M$75
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11190-M-F$215
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11190-NF$215
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11190-NH$215
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11190-NM$215
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11190-NY$215
Humano PARP3 transcript variant 2 clonación del ADN o clonación génica(vector de clonación)HG11190-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Referencias
  • Loseva O, et al. (2010) PARP-3 is a mono-ADP-ribosylase that activates PARP-1 in the absence of DNA. J Biol Chem. 285(11): 8054-60.
  • Lehtio L, et al. (2009) Structural basis for inhibitor specificity in human poly(ADP-ribose) polymerase-3. J Med Chem. 52(9): 3108-11.
  • Rouleau M, et al. (2009) Assessment of PARP-3 distribution in tissues of cynomolgous monkeys. J Histochem Cytochem. 57(7): 675-85.
  • Rouleau M, et al. (2007) PARP-3 associates with polycomb group bodies and with components of the DNA damage repair machinery. J Cell Biochem. 100(2): 385-401.
  • Augustin A, et al. (2003) PARP-3 localizes preferentially to the daughter centriole and interferes with the G1/S cell cycle progression. J Cell Sci. 116(Pt 8): 1551-62.
  • Size / Price
    Catálogo: HG11190-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
    • Human PARP3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"