After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano Actopaxin clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human PARVA Información de producto de clon de cDNA
Gene_bank_ref_id:BC016713
Tamaño de cDNA:1119bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens parvin, alpha with C terminal Flag tag.
Sinónimo de gen:MXRA2, CH-ILKBP
Especie:Human
Vector:pCMV3-C-FLAG
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano Actopaxin clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Humano Actopaxin clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG13919-ACG$225
Humano Actopaxin clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG13919-ACR$225
Humano Actopaxin clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG13919-ANG$225
Humano Actopaxin clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG13919-ANR$225
Humano Actopaxin clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG13919-CF$195
Humano Actopaxin clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG13919-CH$195
Humano Actopaxin clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG13919-CM$195
Humano Actopaxin clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG13919-CY$195
Humano Actopaxin clonación del ADN o clonación génica(Vector de expresión)HG13919-G$75
Humano Actopaxin clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG13919-NF$195
Humano Actopaxin clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG13919-NH$195
Humano Actopaxin clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG13919-NM$195
Humano Actopaxin clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG13919-NY$195
Humano Actopaxin clonación del ADN o clonación génica(vector de clonación)HG13919-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Actopaxin, also known as alpha-parvin, belongs to the parvin family. It is widely expressed, with highest levels in heart, skeletal muscle, kidney and liver. Actopaxin contains 2 CH (calponin-homology) domains and probably plays a role in the regulation of cell adhesion and cytoskeleton organization. It interacts with integrin-linked protein kinase and probably with actin and the LD1 and LD4 motifs of PXN. Actopaxin binds directly to both F-actin and paxillin LD1 and LD4 motifs. Actopaxin also exhibits robust focal adhesion localization in several cultured cell types but is not found along the length of the associated actin-rich stress fibers. It is absent from actin-rich cell-cell adherens junctions.

Referencias
  • Korenbaum E, et al. (2002) Genomic organization and expression profile of the parvin family of focal adhesion proteins in mice and humans. Gene. 279(1):69-79.
  • Nikolopoulos SN, et al. (2002) Molecular dissection of actopaxin-integrin-linked kinase-Paxillin interactions and their role in subcellular localization. J Biol Chem. 277(2): 1568-75.
  • Tu Y, et al. (2001) A new focal adhesion protein that interacts with integrin-linked kinase and regulates cell adhesion and spreading. J Cell Biol. 153(3): 585-98.
  • Size / Price
    Catálogo: HG13919-CF
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"