After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano PDCD4 transcript variant 1 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human PDCD4 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_014456.3
Tamaño de cDNA:1410 bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens programmed cell death 4 (neoplastic transformation inhibitor), transcript variant 1.
Sinónimo de gen:H731
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-PDCD4
Sitio de restricción:KpnI + XbaI(6.1kb+1.41kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at ambient temperature for three months.
Humano PDCD4 transcript variant 1 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano PDCD4 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11193-ACG$225
Humano PDCD4 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11193-ACR$225
Humano PDCD4 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11193-ANG$225
Humano PDCD4 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11193-ANR$225
Humano PDCD4 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11193-CF$195
Humano PDCD4 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11193-CH$195
Humano PDCD4 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11193-CM$195
Humano PDCD4 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11193-CY$195
Humano PDCD4 transcript variant 1 clonación del ADN o clonación génica(Vector de expresión)HG11193-M$75
Humano PDCD4 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11193-NF$195
Humano PDCD4 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11193-NH$195
Humano PDCD4 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11193-NM$195
Humano PDCD4 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11193-NY$195
Humano PDCD4 transcript variant 1 clonación del ADN o clonación génica(vector de clonación)HG11193-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG11193-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
DisponibilidadIn Stock
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"