After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Humano PDRG1 / C20orf126 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human PDRG1 Información de producto de clon de cDNA
Tamaño de cDNA:402bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens p53 and DNA-damage regulated 1 with C terminal Myc tag.
Sinónimo de gen:RP1-310O13.8, C20orf126, PDRG, PDRG1
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano PDRG1 / C20orf126 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
Humano PDRG1 / C20orf126 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14143-ACG$225
Humano PDRG1 / C20orf126 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14143-ACR$225
Humano PDRG1 / C20orf126 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14143-ANG$225
Humano PDRG1 / C20orf126 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14143-ANR$225
Humano PDRG1 / C20orf126 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14143-CF$195
Humano PDRG1 / C20orf126 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14143-CH$195
Humano PDRG1 / C20orf126 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14143-CM$195
Humano PDRG1 / C20orf126 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14143-CY$195
Humano PDRG1 / C20orf126 clonación del ADN o clonación génica(Vector de expresión)HG14143-G$75
Humano PDRG1 / C20orf126 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14143-NF$195
Humano PDRG1 / C20orf126 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14143-NH$195
Humano PDRG1 / C20orf126 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14143-NM$195
Humano PDRG1 / C20orf126 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14143-NY$195
Humano PDRG1 / C20orf126 clonación del ADN o clonación génica(vector de clonación)HG14143-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

PDRG1, also known as C20orf126, belongs to the prefoldin subunit beta family. It is predominantly expressed in normal testis and exhibits reduced but detectable expression in other organs. PDRG1 may play a role in chaperone-mediated protein folding. PDRG1 is overexpressed in tumors relative to normal tissues. Its expression is upregulated in multiple malignancies including cancers of the colon, rectum, ovary, lung, stomach, breast and uterus when compared to their respective matched normal tissues. Thus PDRG1 is a high-value novel tumor marker that could play a role in cancer development and/or progression.

  • Kim W. et al., 2011, Mol Cell. 44 (2): 325-40.
  • Havugimana PC. et al., 2012, Cell. 150 (5): 1068-81.
  • Jiang L. et al., 2011, Cancer Biol Ther. 11 (6): 567-73.
  • Size / Price
    Catálogo: HG14143-CM
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.