Pedido rápido

Humano PFDN4 / PFD4 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano PFDN4 Información de producto de clon de cDNA
    Gene_bank_ref_id:BC010953
    Tamaño de cDNA:405bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens prefoldin subunit 4 with C terminal Myc tag.
    Sinónimo de gen:C1, PFD4, PFDN4
    Especie:Human
    Vector:pCMV3-C-Myc
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PFDN4 qPCR primers for gene expression analysis, HP102796 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Humano PFDN4 / PFD4 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
    Humano PFDN4 / PFD4 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14144-ACG$225
    Humano PFDN4 / PFD4 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14144-ACR$225
    Humano PFDN4 / PFD4 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14144-ANG$225
    Humano PFDN4 / PFD4 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14144-ANR$225
    Humano PFDN4 / PFD4 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14144-CF$195
    Humano PFDN4 / PFD4 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14144-CH$195
    Humano PFDN4 / PFD4 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14144-CM$195
    Humano PFDN4 / PFD4 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14144-CY$195
    Humano PFDN4 / PFD4 clonación del ADN o clonación génica(Vector de expresión)HG14144-G$75
    Humano PFDN4 / PFD4 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14144-NF$195
    Humano PFDN4 / PFD4 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14144-NH$195
    Humano PFDN4 / PFD4 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14144-NM$195
    Humano PFDN4 / PFD4 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14144-NY$195
    Humano PFDN4 / PFD4 clonación del ADN o clonación génica(vector de clonación)HG14144-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    PFDN4 is a member of the prefoldin beta subunit family. It is one of six subunits of prefoldin, a molecular chaperone complex that binds and stabilizes newly synthesized polypeptides, thereby allowing them to fold correctly. The complex, consisting of two alpha and four beta subunits, forms a double beta barrel assembly with six protruding coiled-coils. PFDN4 binds specifically to cytosolic chaperonin (c-CPN) and transfers target proteins to it. PFDN4 also binds to nascent polypeptide chain and promotes folding in an environment in which there are many competing pathways for nonnative proteins.

    Referencias
  • Iijima M, et al. (1996) Cloning of cDNA with possible transcription factor activity at the G1-S phase transition in human fibroblast cell lines. Acta Med Okayama. 50(2):73-7.
  • Hartl FU, et al. (2002) Molecular chaperones in the cytosol: from nascent chain to folded protein. Science. 295(5561):1852-8.
  • Vainberg I, et al. (1998) Prefoldin, a chaperone that delivers unfolded proteins to cytosolic chaperonin. Cell. 93(5):863-73.
  • Size / Price
    Catálogo: HG14144-CM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"