After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Humano PGK1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human PGK1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_000291.3
Tamaño de cDNA:1254bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens phosphoglycerate kinase 1 with C terminal His tag.
Sinónimo de gen:PGKA, MIG10, MGC8947, MGC117307, MGC142128, PGK1
Especie:Human
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano PGK1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano PGK1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11114-ACG$225
Humano PGK1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11114-ACR$225
Humano PGK1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11114-ANG$225
Humano PGK1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11114-ANR$225
Humano PGK1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11114-CF$195
Humano PGK1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11114-CH$195
Humano PGK1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11114-CM$195
Humano PGK1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11114-CY$195
Humano PGK1 clonación del ADN o clonación génica(Vector de expresión)HG11114-M$75
Humano PGK1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11114-M-F$195
Humano PGK1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11114-NF$195
Humano PGK1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11114-NH$195
Humano PGK1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11114-NM$195
Humano PGK1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11114-NY$195
Humano PGK1 clonación del ADN o clonación génica(vector de clonación)HG11114-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Referencias
  • Rush J. et al., 2005, Nat Biotechnol. 23: 94-101.
  • Olsen JV. et al., 2006, Cell. 127: 635-648.
  • Zieker D. et al., 2008, Cell Physiol Biochem. 21 (5-6): 429-36.
  • Jung Y. et al., 2009, Mol Cancer Res. 7 (10): 1595-604.
  • Choudhary C. et al., 2009, Science. 325: 834-40.
  • Size / Price
    Catálogo: HG11114-CH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"