Pedido rápido

Humano PGK1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human PGK1 Información de producto de clon de cDNA
Tamaño de cDNA:1254bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens phosphoglycerate kinase 1 with C terminal His tag.
Sinónimo de gen:PGKA, MIG10, MGC8947, MGC117307, MGC142128, PGK1
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano PGK1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano PGK1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11114-ACG$225
Humano PGK1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11114-ACR$225
Humano PGK1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11114-ANG$225
Humano PGK1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11114-ANR$225
Humano PGK1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11114-CF$195
Humano PGK1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11114-CH$195
Humano PGK1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11114-CM$195
Humano PGK1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11114-CY$195
Humano PGK1 clonación del ADN o clonación génica(Vector de expresión)HG11114-M$75
Humano PGK1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11114-M-F$195
Humano PGK1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11114-NF$195
Humano PGK1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11114-NH$195
Humano PGK1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11114-NM$195
Humano PGK1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11114-NY$195
Humano PGK1 clonación del ADN o clonación génica(vector de clonación)HG11114-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
  • Rush J. et al., 2005, Nat Biotechnol. 23: 94-101.
  • Olsen JV. et al., 2006, Cell. 127: 635-648.
  • Zieker D. et al., 2008, Cell Physiol Biochem. 21 (5-6): 429-36.
  • Jung Y. et al., 2009, Mol Cancer Res. 7 (10): 1595-604.
  • Choudhary C. et al., 2009, Science. 325: 834-40.
  • Size / Price
    Catálogo: HG11114-CH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.