Pedido rápido

Text Size:AAA

Humano PGM3/phosphoglucomutase 3 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano PGM3 Información de producto de clon de cDNA
    Gene_bank_ref_id:BC001258
    Tamaño de cDNA:1629bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens phosphoglucomutase 3 with N terminal His tag.
    Sinónimo de gen:AGM1, PAGM, PGM 3
    Especie:Human
    Vector:pCMV3-N-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PGM3 qPCR primers for gene expression analysis, HP103483 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Humano PGM3/phosphoglucomutase 3 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
    Humano PGM3/phosphoglucomutase 3 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14852-ACG$245
    Humano PGM3/phosphoglucomutase 3 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14852-ACR$245
    Humano PGM3/phosphoglucomutase 3 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14852-ANG$245
    Humano PGM3/phosphoglucomutase 3 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14852-ANR$245
    Humano PGM3/phosphoglucomutase 3 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14852-CF$215
    Humano PGM3/phosphoglucomutase 3 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14852-CH$215
    Humano PGM3/phosphoglucomutase 3 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14852-CM$215
    Humano PGM3/phosphoglucomutase 3 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14852-CY$215
    Humano PGM3/phosphoglucomutase 3 clonación del ADN o clonación génica(Vector de expresión)HG14852-G$75
    Humano PGM3/phosphoglucomutase 3 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14852-NF$215
    Humano PGM3/phosphoglucomutase 3 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14852-NH$215
    Humano PGM3/phosphoglucomutase 3 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14852-NM$215
    Humano PGM3/phosphoglucomutase 3 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14852-NY$215
    Humano PGM3/phosphoglucomutase 3 clonación del ADN o clonación génica(vector de clonación)HG14852-UT$215
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: HG14852-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"