Pedido rápido

Humano PLA2G4F clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano PLA2G4F Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_213600.3
    Tamaño de cDNA:2550bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens phospholipase A2, group IVF with N terminal His tag.
    Sinónimo de gen:PLA2G4FZ, PLA2G4F
    Especie:Human
    Vector:pCMV3-N-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PLA2G4F qPCR primers for gene expression analysis, HP102350 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Humano PLA2G4F clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
    Humano PLA2G4F clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG13671-ACG$325
    Humano PLA2G4F clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG13671-ACR$325
    Humano PLA2G4F clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG13671-ANG$325
    Humano PLA2G4F clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG13671-ANR$325
    Humano PLA2G4F clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG13671-CF$295
    Humano PLA2G4F clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG13671-CH$295
    Humano PLA2G4F clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG13671-CM$295
    Humano PLA2G4F clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG13671-CY$295
    Humano PLA2G4F clonación del ADN o clonación génica(Vector de expresión)HG13671-G$75
    Humano PLA2G4F clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG13671-NF$295
    Humano PLA2G4F clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG13671-NH$295
    Humano PLA2G4F clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG13671-NM$295
    Humano PLA2G4F clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG13671-NY$295
    Humano PLA2G4F clonación del ADN o clonación génica(vector de clonación)HG13671-UT$295
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: HG13671-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"