After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano Urokinase/PLAU clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human PLAU Información de producto de clon de cDNA
Tamaño de cDNA:1296bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens plasminogen activator, urokinase with N terminal Myc tag.
Sinónimo de gen:ATF, UPA, URK, u-PA, UROKINASE, PLAU
Sitio de restricción:KpnI + XbaI (6kb + 1.33kb)
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human PLAU Gene Plasmid Map
Human PLAU / UPA natural ORF mammalian expression plasmid, N-Myc tag
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano Urokinase/PLAU clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Product nameProduct name

Plasminogen activator, urokinase, also known as PLAU and uPA, is a serine protease which converts plasminogen to plasmin, a broad-spectrum protease active on extracellular matrix (ECM) components. It is involved in complement activation, cell migration, wound healing, and generation of localized extracellular proteolysis during tissue remodelling, pro-hormone conversion, carcinogenesis and neoplasia. Like many components of the blood coagulation, fibrinolytic and complement cascades, uPA has a modular structure, including three conserved domains: a growth factor-like domain (GFD, residues 1-49), a kringle domain (residues 50-131), linked by an interdomain linker or "connecting peptide" (CP, residues 132-158) to the serine protease domain (residues 159-411). uPA and its receptor (uPAR) have been implicated in a broad spectrum of pathophysiological processes, including fibrinolysis, proteolysis, inflammation, atherogenesis and plaque destabilization, all of which are involved in the pathogenesis of MI (myocardial infarction). The role of uPA is not only linked to its action as an enzyme. In fact, the mere binding of uPA on the cell surface also brings about two events that broaden the spectrum of its biological functions: (1) a conformational change of the receptor, which, in turn, affects its interaction with other proteins; (2) a signal transduction which modulates the expression of apoptosis-related genes. Besides its applications as a thrombolytic agent and as a prognostic marker for tumors, uPA may provide the basis for other therapies, as the structure of the receptor-binding domain of uPA has become a model for the design of anti-cancer molecules. Because of the causal involvment of uPA in cancer invasion and metastasis, the blockade of uPA interactions and activity with specific inhibitors is of interest for novel strategies in cancer therapy.

  • Crippa MP. (2007) Urokinase-type plasminogen activator. Int J Biochem Cell Biol. 39(4): 690-4.
  • Kunamneni A, et al. (2008) Urokinase-a very popular cardiovascular agent. Recent Pat Cardiovasc Drug Discov. 3(1): 45-58.
  • Vincenza Carriero M, et al. (2009) Structure, function and antagonists of urokinase-type plasminogen activator. Front Biosci. 14: 3782-94.
  • Xu J, et al. (2010) Association of putative functional variants in the PLAU gene and the PLAUR gene with myocardial infarction. Clin Sci (Lond). 119(8): 353-9.
  • Size / Price
    Catálogo: HG10815-NM
    Precio de lista: 
    Precio:      (You Save: )
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.