After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano PLK1/PLK-1 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human PLK1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_005030.3
Tamaño de cDNA:1812bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens polo-like kinase 1 (Drosophila).
Sinónimo de gen:PLK, STPK13, PLK1
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-PLK1
Sitio de restricción:HindIII + XbaI (6.1kb + 1.81kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human PLK1 Gene Plasmid Map
Human PLK1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano PLK1/PLK-1 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano PLK1/PLK-1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10676-ACG$245
Humano PLK1/PLK-1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10676-ACR$245
Humano PLK1/PLK-1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10676-ANG$245
Humano PLK1/PLK-1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10676-ANR$245
Humano PLK1/PLK-1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10676-CF$215
Humano PLK1/PLK-1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10676-CH$215
Humano PLK1/PLK-1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10676-CM$215
Humano PLK1/PLK-1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10676-CY$215
Humano PLK1/PLK-1 clonación del ADN o clonación génica(Vector de expresión)HG10676-M$75
Humano PLK1/PLK-1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10676-M-F$215
Humano PLK1/PLK-1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10676-NF$215
Humano PLK1/PLK-1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10676-NH$215
Humano PLK1/PLK-1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10676-NM$215
Humano PLK1/PLK-1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10676-NY$215
Humano PLK1/PLK-1 clonación del ADN o clonación génica(vector de clonación)HG10676-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Serine / threonine-protein kinase PLK1 / PLK-1, also known as polo-like kinase 1 (PLK-1) or serine / threonine-protein kinase 13 (STPK13), Polo-like kinases (PLKs), is a family of four serine / threonine protein kinases that are critical regulators of cell cycle progression, mitosis, cytokinesis, and the DNA damage response. PLK1 / PLK-1 is ubiquitously expressed. The mRNA and protein expression of PLK1 / PLK-1, -2 and -4 are coordinately regulated during cell cycle progression, but PLK3 levels are independent of the other three family members. PLK1 / PLK-1 is the most well characterized member of this family and strongly promotes the progression of cells through mitosis. During the various stages of mitosis PLK1 / PLK-1 localizes to the centrosomes, kinetochores and central spindle. PLKs are dysregulated in a variety of human cancers. PLK1 / PLK-1 overexpression correlates with cellular proliferation and poor prognosis. Serine / threonine-protein kinase that performs several important functions throughout M phase of the cell cycle, including the regulation of centrosome maturation and spindle assembly, the removal of cohesins from chromosome arms, the inactivation of APC / C inhibitors, and the regulation of mitotic exit and cytokinesis. It is required for recovery after DNA damage checkpoint and entry into mitosis. PLK1 / PLK-1 is required for kinetochore localization of BUB1B, spindle pole localization of isoform 3 of SGOL1 and plays a role in regulating its centriole cohesion function. PLK1 / PLK-1 Phosphorylates BORA, and thereby promotes the degradation of BORA. PLK1 / PLK-1 also contributes to the regulation of AURKA function and phosphorylates SGOL1.

Referencias
  • Lee KS, et al. (2008) Self-regulated mechanism of Plk1 localization to kinetochores: lessons from the Plk1-PBIP1 interaction. Cell Div. 3: 4.
  • Zhou T, et al. (2003) A role for Plk1 phosphorylation of NudC in cytokinesis. Dev Cell. 5 (1): 127-38.
  • Lee M, et al. (2004) Phosphorylation of BRCA2 by the Polo-like kinase Plk1 is regulated by DNA damage and mitotic progression. Oncogene. 23 (4): 865-72.
  • Size / Price
    Catálogo: HG10676-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
    • Human PLK1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"