Pedido rápido

Text Size:AAA

Humano phosphomannomutase 2 / PMM2 / CDG1 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human PMM2 Información de producto de clon de cDNA
Tamaño de cDNA:741bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens phosphomannomutase 2 with N terminal HA tag.
Sinónimo de gen:PMI, CDG1, CDGS, PMI1, CDG1a, PMM 2
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano phosphomannomutase 2 / PMM2 / CDG1 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta on other vectors
Humano phosphomannomutase 2 / PMM2 / CDG1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14648-ACG$225
Humano phosphomannomutase 2 / PMM2 / CDG1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14648-ACR$225
Humano phosphomannomutase 2 / PMM2 / CDG1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14648-ANG$225
Humano phosphomannomutase 2 / PMM2 / CDG1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14648-ANR$225
Humano phosphomannomutase 2 / PMM2 / CDG1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14648-CF$195
Humano phosphomannomutase 2 / PMM2 / CDG1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14648-CH$195
Humano phosphomannomutase 2 / PMM2 / CDG1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14648-CM$195
Humano phosphomannomutase 2 / PMM2 / CDG1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14648-CY$195
Humano phosphomannomutase 2 / PMM2 / CDG1 clonación del ADN o clonación génica(Vector de expresión)HG14648-G$75
Humano phosphomannomutase 2 / PMM2 / CDG1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14648-NF$195
Humano phosphomannomutase 2 / PMM2 / CDG1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14648-NH$195
Humano phosphomannomutase 2 / PMM2 / CDG1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14648-NM$195
Humano phosphomannomutase 2 / PMM2 / CDG1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14648-NY$195
Humano phosphomannomutase 2 / PMM2 / CDG1 clonación del ADN o clonación génica(vector de clonación)HG14648-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Phosphomannomutase 2, also known as PMM2 and CDG1, belongs to the eukaryotic PMM family. Phosphomannomutase 2 catalyzes the isomerization of mannose 6-phosphate to mannose 1-phosphate. Mannose 1-phosphate is a precursor to GDP-mannose necessary for the synthesis of dolichol-P-oligosaccharides. GDP-mannose can transfer its small sugar molecule called mannose to the growing oligosaccharide chain. Once the correct number of small sugar molecules are linked together to form the oligosaccharide, it can be attached to a protein. Phosphomannomutase 2 is also required for a number of critical mannosyl transfer reactions. Mutations in PMM2 gene have been shown to cause defects in the protein glycosylation pathway manifest as carbohydrate-deficient glycoprotein syndrome type I.

  • Jaeken J. et al., 2002, Annual review of genomics and human genetics. 2: 129-51.
  • Matthijs G. et al., 2000, Mol Genet Metab. 68 (2): 220-6.
  • Matthijs G. et al., 1997, Nat Genet. 16 (1): 88-92.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.