Pedido rápido

Humano Galactolipase / PNLIPRP2 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Humano PNLIPRP2 Información de producto de clon de cDNA
Tamaño de cDNA:1410bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens pancreatic lipase-related protein 2 with N terminal His tag.
Sinónimo de gen:PLRP2
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
( We provide with PNLIPRP2 qPCR primers for gene expression analysis, HP102366 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano Galactolipase / PNLIPRP2 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano Galactolipase / PNLIPRP2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG13687-ACG$225
Humano Galactolipase / PNLIPRP2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG13687-ACR$225
Humano Galactolipase / PNLIPRP2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG13687-CF$195
Humano Galactolipase / PNLIPRP2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG13687-CH$195
Humano Galactolipase / PNLIPRP2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG13687-CM$195
Humano Galactolipase / PNLIPRP2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG13687-CY$195
Humano Galactolipase / PNLIPRP2 clonación del ADN o clonación génica(Vector de expresión)HG13687-G$75
Humano Galactolipase / PNLIPRP2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG13687-NF$195
Humano Galactolipase / PNLIPRP2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG13687-NH$195
Humano Galactolipase / PNLIPRP2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG13687-NM$195
Humano Galactolipase / PNLIPRP2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG13687-NY$195
Humano Galactolipase / PNLIPRP2 clonación del ADN o clonación génica(vector de clonación)HG13687-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Galactolipase, also known as PNLIPRP2, is a lipase with broad substrate specificity. It can hydrolyze both phospholipids and galactolipids. Galactolipase acts preferentially on monoglycerides, phospholipids and galactolipids. It also hydrolyses milk fat with a lower catalytic efficiency. The expressed galactolipase shows a lipolytic activity that is, however, only marginally dependent on the presence of colipase. The lipolytic activity of pancreatic extracts and human pancreatic juice on Labrasol is mainly due to the combined action of carboxyl ester hydrolase and galactolipase.

  • Andersson EL, et al. (2011) BSSL and PLRP2: key enzymes for lipid digestion in the newborn examined using the Caco-2 cell line. J Lipid Res. 52(11):1949-56.
  • Xiao X, et al. (2011) Pancreatic lipase-related protein-2 (PLRP2) can contribute to dietary fat digestion in human newborns. J Biol Chem. 286(30):26353-63.
  • Alves BN, et al. (2009) Lipid-dependent cytotoxicity by the lipase PLRP2 and by PLRP2-positive cytotoxic T lymphocytes (CTLs). Cell Biochem Funct. 27(5):296-308.
  • Size / Price
    Catálogo: HG13687-NH
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.