POMGNT1 cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

POMGNT1 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1983 bp
Description
Full length Clone DNA of Human protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

POMGNT1 cDNA ORF Clone, Human, N-Myc tag: Alternative Names

gnT-I.2 cDNA ORF Clone, Human; GNTI.2 cDNA ORF Clone, Human; LGMD2O cDNA ORF Clone, Human; MEB cDNA ORF Clone, Human; MGAT1.2 cDNA ORF Clone, Human

POMGNT1 Background Information

Full Name
protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-)
Add to Cart Successfully Add to Cart Failed