Pedido rápido

Humano PPARG clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human PPARG Información de producto de clon de cDNA
Gene_bank_ref_id:NM_015869.4
Tamaño de cDNA:1518bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens peroxisome proliferator-activated receptor gamma.
Sinónimo de gen:PPARG1, PPARG2, NR1C3, PPARgamma
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-PPARG
Sitio de restricción:KpnI + XbaI (6.1kb + 1.52kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human PPARG Gene Plasmid Map
Human PPARG Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano PPARG clonación del ADN o clonación génica(vector de clonación) on other vectors
Product nameProduct name
Referencias
  • Hamblin M, et al. (2009) PPARs and the Cardiovascular System. Antioxid Redox Signal. 11 (6): 1415-52.
  • Khateeb J, et al. (2010) Paraoxonase 1 (PON1) expression in hepatocytes is upregulated by pomegranate polyphenols: a role for PPAR-gamma pathway. Atherosclerosis. 208 (1): 119-25.
  • Fajas L, et al. (1997) The organization, promoter analysis, and expression of the human PPARgamma gene. J Biol Chem. 272 (30): 18779-89.
  • Size / Price
    Catálogo: HG12019-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
    • Human PPARG Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"