Pedido rápido

Humano PPP3CA transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human PPP3CA Información de producto de clon de cDNA
Tamaño de cDNA:1566bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens protein phosphatase 3, catalytic subunit, alpha isozyme, transcript variant 1 with N terminal His tag.
Sinónimo de gen:CALN, CCN1, CNA1, CALNA, PPP2B, CALNA1, PPP3CA
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano PPP3CA transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano PPP3CA transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG13670-ACG$245
Humano PPP3CA transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG13670-ACR$245
Humano PPP3CA transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG13670-ANG$245
Humano PPP3CA transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG13670-ANR$245
Humano PPP3CA transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG13670-CF$215
Humano PPP3CA transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG13670-CH$215
Humano PPP3CA transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG13670-CM$215
Humano PPP3CA transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG13670-CY$215
Humano PPP3CA transcript variant 1 clonación del ADN o clonación génica(Vector de expresión)HG13670-G$75
Humano PPP3CA transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG13670-NF$215
Humano PPP3CA transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG13670-NH$215
Humano PPP3CA transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG13670-NM$215
Humano PPP3CA transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG13670-NY$215
Humano PPP3CA transcript variant 1 clonación del ADN o clonación génica(vector de clonación)HG13670-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name

PPP3CA, also known as protein phosphatase 2B, is a member of the PPP phosphatase family, PP-2B subfamily. It is the alpha catalytic subunit of protein phosphatase 2B (PP2B). PP2B is a holoenzyme that is comprised of a catalytic subunit associated with regulatory subunits. It is a calcium regulated enzyme that is activated by calmodulin and participates in the signaling cascades involved in development of the nervous, cardiovascular, and musculoskeletal systems. PPP3CA activates the T cells of the immune system and can be blocked by drugs. It also activates NFATc (a transcription factor) by dephosphorylating it. The activated NFATc is subsequently translocated into the nucleus, where it upregulates the expression of interleukin 2. PPP3CA interacts with CRTC2, MYOZ1, MYOZ2 and MYOZ3. It also interacts with DNM1L. The interaction dephosphorylates DNM1L and regulates its translocation to mitochondria.

  • Frey N, et al. (2002) Calsarcin-3, a Novel Skeletal Muscle-specific Member of the Calsarcin Family, Interacts with Multiple Z-disc Proteins. Journal of Biological Chemistry. 277(16): 13998-4004.
  • Frey N, et al. (2000) Calsarcins, a novel family of sarcomeric calcineurin-binding proteins. Proceedings of the National Academy of Sciences. 97(26):14632-7.
  • Crabtree G R, et al. (1999) Generic signals and specific outcomes: Signaling through Ca2+, calcineurin, and NF-AT. Cell. 96(5):611-4.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.