After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human PRDX1 Información de producto de clon de cDNA
Gene_bank_ref_id:BC007063.1
Tamaño de cDNA:600bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens peroxiredoxin 1.
Sinónimo de gen:PAG, PAGA, PAGB, PRX1, PRXI, MSP23, NKEFA, TDPX2, PRDX1
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-PRDX1
Sitio de restricción:KpnI + XbaI (6.1kb + 0.6kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human PRDX1 Gene Plasmid Map
Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11194-ACG$225
Humano Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11194-ACR$225
Humano Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11194-ANG$225
Humano Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11194-ANR$225
Humano Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11194-CF$195
Humano Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11194-CH$195
Humano Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11194-CM$195
Humano Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11194-CY$195
Humano Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(Vector de expresión)HG11194-M$75
Humano Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11194-M-F$195
Humano Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11194-NF$195
Humano Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11194-NH$195
Humano Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11194-NM$195
Humano Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11194-NY$195
Humano Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación)HG11194-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Peroxiredoxin-1, also known as Thioredoxin peroxidase 2, Natural killer cell-enhancing factor A, PRDX1, and PAGA, is a member of the ahpC/TSA family. Peroxiredoxin-1 is constitutively expressed in most human cells. It is induced to higher levels upon serum stimulation in untransformed and transformed cells. Peroxiredoxins (PRDXs) are a family of antioxidant enzymes that are also known as scavengers of peroxide in mammalian cells. The overexpression of Peroxiredoxin-1, which is one of the peroxiredoxins that is a ubiquitously expressed protein, was related to a poor prognosis in several types of human cancers. Peroxiredoxin-1 is involved in redox regulation of the cell. It reduces peroxides with reducing equivalents provided through the thioredoxin system but not from glutaredoxin and may play an important role in eliminating peroxides generated during metabolism. Peroxiredoxin-1 Might participate in the signaling cascades of growth factors and tumor necrosis factor-alpha by regulating the intracellular concentrations of H2O2. The reduced Peroxiredoxin-1 expression is an important factor in esophageal squamous cancer progression and could serve as a useful prognostic marker.

Referencias
  • Neumann, CA. et al., 2003, Nature 424 (6948): 561-5
  • Gisin, J. et al., 2005, J Clin Pathol. 58 (11): 1229-31.
  • Hoshino, I. et al., 2007, Oncol Rep. 18 (4): 867-71.
  • Cao, J. et al., 2009, EMBO J. 28 (10): 1505-17.
  • Size / Price
    Catálogo: HG11194-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
    • Human PRDX1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"