Pedido rápido

Humano PRICKLE2 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano PRICKLE2 Información de producto de clon de cDNA
    Tamaño de cDNA:2535bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens prickle homolog 2 (Drosophila) with N terminal His tag.
    Sinónimo de gen:EPM5
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    ( We provide with PRICKLE2 qPCR primers for gene expression analysis, HP104552 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Humano PRICKLE2 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
    Humano PRICKLE2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG15965-ACG$325
    Humano PRICKLE2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG15965-ACR$325
    Humano PRICKLE2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG15965-ANG$325
    Humano PRICKLE2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG15965-ANR$325
    Humano PRICKLE2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG15965-CF$295
    Humano PRICKLE2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG15965-CH$295
    Humano PRICKLE2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG15965-CM$295
    Humano PRICKLE2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG15965-CY$295
    Humano PRICKLE2 clonación del ADN o clonación génica(Vector de expresión)HG15965-G$75
    Humano PRICKLE2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG15965-NF$295
    Humano PRICKLE2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG15965-NH$295
    Humano PRICKLE2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG15965-NM$295
    Humano PRICKLE2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG15965-NY$295
    Humano PRICKLE2 clonación del ADN o clonación génica(vector de clonación)HG15965-UT$295
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: HG15965-NH
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.