Pedido rápido

Text Size:AAA

Humano PRKCB clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human PRKCB Información de producto de clon de cDNA
Tamaño de cDNA:2022bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens protein kinase C, beta with N terminal His tag.
Sinónimo de gen:PKCB, PRKCB1, PRKCB2, MGC41878, PKC-beta, PRKCB
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano PRKCB clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano PRKCB clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10750-ACG$245
Humano PRKCB clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10750-ACR$245
Humano PRKCB clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10750-ANG$245
Humano PRKCB clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10750-ANR$245
Humano PRKCB clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10750-CF$215
Humano PRKCB clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10750-CH$215
Humano PRKCB clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10750-CM$215
Humano PRKCB clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10750-CY$215
Humano PRKCB clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10750-NF$215
Humano PRKCB clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10750-NH$215
Humano PRKCB clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10750-NM$215
Humano PRKCB clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10750-NY$215
Humano PRKCB clonación del ADN o clonación génica(Vector de expresión)HG10750-U$75
Humano PRKCB clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10750-U-F$215
Humano PRKCB clonación del ADN o clonación génica(vector de clonación)HG10750-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG10750-NH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.