Pedido rápido

Humano PRKCB clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano PRKCB Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_002738.6
    Tamaño de cDNA:2022bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens protein kinase C, beta with N terminal His tag.
    Sinónimo de gen:PKCB, PRKCB1, PRKCB2, MGC41878, PKC-beta, PRKCB
    Especie:Human
    Vector:pCMV3-N-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PRKCB qPCR primers for gene expression analysis, HP100683 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Humano PRKCB clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
    Humano PRKCB clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10750-ACG$245
    Humano PRKCB clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10750-ACR$245
    Humano PRKCB clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10750-ANG$245
    Humano PRKCB clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10750-ANR$245
    Humano PRKCB clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10750-CF$215
    Humano PRKCB clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10750-CH$215
    Humano PRKCB clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10750-CM$215
    Humano PRKCB clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10750-CY$215
    Humano PRKCB clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10750-NF$215
    Humano PRKCB clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10750-NH$215
    Humano PRKCB clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10750-NM$215
    Humano PRKCB clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10750-NY$215
    Humano PRKCB clonación del ADN o clonación génica(Vector de expresión)HG10750-U$75
    Humano PRKCB clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10750-U-F$215
    Humano PRKCB clonación del ADN o clonación génica(vector de clonación)HG10750-UT$215
     Más información sobre los vectores de expresión
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"