Pedido rápido

Text Size:AAA

Humano GLRX3/PRKCT clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human PRKCQ Información de producto de clon de cDNA
Tamaño de cDNA:2121bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens protein kinase C, theta with N terminal His tag.
Sinónimo de gen:PRKCT, nPKC-theta
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano GLRX3/PRKCT clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano GLRX3/PRKCT clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10091-ACG$245
Humano GLRX3/PRKCT clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10091-ACR$245
Humano GLRX3/PRKCT clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10091-ANG$245
Humano GLRX3/PRKCT clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10091-ANR$245
Humano GLRX3/PRKCT clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10091-CF$215
Humano GLRX3/PRKCT clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10091-CH$215
Humano GLRX3/PRKCT clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10091-CM$215
Humano GLRX3/PRKCT clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10091-CY$215
Humano GLRX3/PRKCT clonación del ADN o clonación génica(Vector de expresión)HG10091-G$75
Humano GLRX3/PRKCT clonación del ADN o clonación génica(vector de clonación)HG10091-M-N$215
Humano GLRX3/PRKCT clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10091-NF$215
Humano GLRX3/PRKCT clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10091-NH$215
Humano GLRX3/PRKCT clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10091-NM$215
Humano GLRX3/PRKCT clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10091-NY$215
Humano GLRX3/PRKCT clonación del ADN o clonación génica(vector de clonación)HG10091-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG10091-NH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.