After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano Epcr/PROCR clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human PROCR Información de producto de clon de cDNA
Gene_bank_ref_id:BC014451
Tamaño de cDNA:717bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens protein C receptor, endothelial (EPCR) with C terminal Flag tag.
Sinónimo de gen:CCCA, EPCR, CCD41, CD201, bA42O4.2, PROCR
Especie:Human
Vector:pCMV3-C-FLAG
Plasmid:pCMV3-PROCR-Flag
Sitio de restricción:HindIII + NotI (6kb + 0.77kb)
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human PROCR Gene Plasmid Map
Human PROCR Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
Human PROCR Gene Expression validated Image
Human PROCR ORF mammalian expression plasmid, C-Flag tag
[Hacer clic para ampliar la imagen]
Caption:
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Fondo

Endothelial protein C receptor (EPCR), also known as activated protein C receptor (APC receptor) or PROCR, is a receptor for Protein C. Protein C plays an important role in many metabolism processes in humans and other animals after activated by binding to Endothelial protein C receptor (EPCR). Because of the EPCR is found primarily on endothelial cells (cells on the inside of blood vessels), activated protein C is found maily near endothelial cells. Protein C is pleiotropic, with two main functions: anticoagulation and cytoprotection. Which function will be performed depend on whether or not protein C remains bind to EPCR after activated. The anticoagulation occurs when it does not. In this case, protein C functions as an anticoagulant by irreversibly proteolytically inactivating Factor Va and Factor VIIIa, turning them into Factor Vi and Factor VIIIi respectively. When still bound to EPCR, activated protein C performs its cytoprotective effects, acting on the effector substrate PAR-1, protease-activated receptor-1. To a degree, APC's anticoagulant properties are independent of its cytoprotective ones, in that expression of one pathway is not affected by the existence of the other. 

Referencias
  • Nicolaes GA, et al. (2003). Congenital and acquired activated protein C resistance. Semin Vasc Med. 3 (1): 33-46.
  • Esmon CT. ( 2003). The protein C pathway. Chest 124 (3): 26-32.
  • Mosnier LO, et al. (2007)The cytoprotective protein C pathway. Blood. 109: 3161-72.
  • Size / Price
    Catálogo: HG13320-CF
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
    • Human PROCR Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
    • Human PROCR ORF mammalian expression plasmid, C-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"