Pedido rápido

Humano PSMB8 clonación del ADN o clonación génica(vector de clonación)

  • Human PSMB8 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Hoja de datosReseñasProductos relacionadosProtocolos
Humano PSMB8 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_004159.4
Tamaño de cDNA:819bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional peptidase 7).
Sinónimo de gen:LMP7, D6S216, PSMB5i, RING10, D6S216E, MGC1491, PSMB8
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-PSMB8
Sitio de restricción:KpnI + XbaI (6.1kb + 0.82kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with PSMB8 qPCR primers for gene expression analysis, HP101564 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano PSMB8 Gene Plasmid Map
Human PSMB8 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano PSMB8 clonación del ADN o clonación génica(vector de clonación) on other vectors
Product nameProduct name
Size / Price
Catálogo: HG12028-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad
Añadir a carroBulk Discount Requiry

Datasheet & Documentation

Contact Us
    Artículos vistos recientemente
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"