Pedido rápido

Humano PSME2 / PA28b clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human PSME2 Información de producto de clon de cDNA
Tamaño de cDNA:720bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens proteasome (prosome, macropain) activator subunit 2 (PA28 beta) with N terminal HA tag.
Sinónimo de gen:PA28B, REGbeta, PA28beta
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano PSME2 / PA28b clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta on other vectors
Humano PSME2 / PA28b clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14640-ACG$225
Humano PSME2 / PA28b clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14640-ACR$225
Humano PSME2 / PA28b clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14640-ANG$225
Humano PSME2 / PA28b clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14640-ANR$225
Humano PSME2 / PA28b clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14640-CF$195
Humano PSME2 / PA28b clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14640-CH$195
Humano PSME2 / PA28b clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14640-CM$195
Humano PSME2 / PA28b clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14640-CY$195
Humano PSME2 / PA28b clonación del ADN o clonación génica(Vector de expresión)HG14640-G$75
Humano PSME2 / PA28b clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14640-NF$195
Humano PSME2 / PA28b clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14640-NH$195
Humano PSME2 / PA28b clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14640-NM$195
Humano PSME2 / PA28b clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14640-NY$195
Humano PSME2 / PA28b clonación del ADN o clonación génica(vector de clonación)HG14640-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

PSME2, also known as PA28b, is a subunit of proteasome. The 26S proteasome multicatalytic proteinase complex has a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. PSME2 gene encodes the beta subunit of the 11S regulator, one of the two 11S subunits that is induced by gamma-interferon. Three beta and three alpha subunits combine to form a heterohexameric ring.

  • Ahn K. et al., 1996, J Biol Chem. 271 (30): 18237-42.
  • Rual Jean-François. et al., 2005, Nature. 437 (7062): 1173-8.
  • Ahn JY. et al., 1995, FEBS Lett. 366 (1): 37-42.
  • Size / Price
    Catálogo: HG14640-NY
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.