Pedido rápido

Text Size:AAA

Humano COX-2/PTGS2 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human PTGS2 Información de producto de clon de cDNA
Tamaño de cDNA:1815bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) with C terminal His tag.
Sinónimo de gen:COX2
Sitio de restricción:KpnI + XbaI (6kb + 1.86kb)
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human PTGS2 Gene Plasmid Map
Human PTGS2 ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano COX-2/PTGS2 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano COX-2/PTGS2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG12036-ACG$245
Humano COX-2/PTGS2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG12036-ACR$245
Humano COX-2/PTGS2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG12036-ANG$245
Humano COX-2/PTGS2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG12036-ANR$245
Humano COX-2/PTGS2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG12036-CF$215
Humano COX-2/PTGS2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG12036-CH$215
Humano COX-2/PTGS2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG12036-CM$215
Humano COX-2/PTGS2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG12036-CY$215
Humano COX-2/PTGS2 clonación del ADN o clonación génica(Vector de expresión)HG12036-G$75
Humano COX-2/PTGS2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG12036-NF$215
Humano COX-2/PTGS2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG12036-NH$215
Humano COX-2/PTGS2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG12036-NM$215
Humano COX-2/PTGS2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG12036-NY$215
Humano COX-2/PTGS2 clonación del ADN o clonación génica(vector de clonación)HG12036-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name

PTGS2, also known as COX-2, is s component of Prostaglandin-endoperoxide synthase (PTGS). PTGS, also known as cyclooxygenase, is the key enzyme in prostaglandin biosynthesis, and acts both as a dioxygenase and as a peroxidase. There are two isozymes of PTGS: a constitutive PTGS1 and an inducible PTGS2, which differ in their regulation of expression and tissue distribution. PTGS2 is over expressed in many cancers. The overexpression of PTGS2 along with increased angiogenesis and GLUT-1 expression is significantly associated with gallbladder carcinomas. Furthermore the product of COX-2, PGH2 is converted by prostaglandin E2 synthase into PGE2, which in turn can stimulate cancer progression. Consequently inhibiting COX-2 may have benefit in the prevention and treatment of these types of cancer. PTGS2 is regulated by specific stimulatory events, suggesting that it is responsible for the prostanoid biosynthesis involved in inflammation and mitogenesis. It mediates the formation of prostaglandins from arachidonate and may have a role as a major mediator of inflammation and/or a role for prostanoid signaling in activity-dependent plasticity.

  • Picot, et al. (1994) The X-ray crystal structure of the membrane protein prostaglandin H2 synthase-1. Nature. 367(6460):243-9.
  • Xie W, et al. (1991) Expression of a Mitogen-Responsive Gene Encoding Prostaglandin Synthase is Regulated by mRNA Splicing. Proceedings of the National Academy of Sciences. 88(7):2692-6.
  • Hla T, et al. (1992) Human Cyclooxygenase-2 cDNA. Proceedings of the National Academy of Sciences. 89(16):7384-8.
  • Size / Price
    Catálogo: HG12036-CH
    Precio de lista: 
    Precio:      (You Save: )
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    • Human PTGS2 ORF mammalian expression plasmid, C-His tag
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.