After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano SHP2 / PTPN11 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human PTPN11 Información de producto de clon de cDNA
Gene_bank_ref_id:BC008692
Tamaño de cDNA:1383bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens protein tyrosine phosphatase, non-receptor type 11 with N terminal His tag.
Sinónimo de gen:CFC, NS1, SHP2, BPTP3, PTP2C, PTP-1D, SH-PTP2, SH-PTP3, PTPN11
Especie:Human
Vector:pCMV3-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano SHP2 / PTPN11 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano SHP2 / PTPN11 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG12318-ACG$225
Humano SHP2 / PTPN11 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG12318-ACR$225
Humano SHP2 / PTPN11 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG12318-ANG$225
Humano SHP2 / PTPN11 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG12318-ANR$225
Humano SHP2 / PTPN11 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG12318-CF$195
Humano SHP2 / PTPN11 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG12318-CH$195
Humano SHP2 / PTPN11 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG12318-CM$195
Humano SHP2 / PTPN11 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG12318-CY$195
Humano SHP2 / PTPN11 clonación del ADN o clonación génica(Vector de expresión)HG12318-G$75
Humano SHP2 / PTPN11 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG12318-NF$195
Humano SHP2 / PTPN11 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG12318-NH$195
Humano SHP2 / PTPN11 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG12318-NM$195
Humano SHP2 / PTPN11 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG12318-NY$195
Humano SHP2 / PTPN11 clonación del ADN o clonación génica(vector de clonación)HG12318-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

SHP2, also known as PTPN11, belongs to the protein-tyrosine phosphatase(PTP) family, non-receptor class 2 subfamily. PTPs catalyze the removal of phosphate groups from tyrosine residues by the hydrolysis of phosphoric acid monoesters. They dephosphorylate EGFR, JAK2 and TYK2 kinases, promoting oncogenic transformation. SHP2 is widely expressed, with highest levels in heart, brain, and skeletal muscle. SHP2 acts downstream of various receptor and cytoplasmic protein tyrosine kinases to participate in the signal transduction from the cell surface to the nucleus. It also dephosphorylates ROCK2 at Tyr-722 resulting in stimulatation of its RhoA binding activity.

Referencias
  • Ganju R K, et al. (2000) Beta-chemokine receptor CCR5 signals through SHP1, SHP2, and Syk. J Biol Chem. 275(23):17263-8.
  • Yin T, et al. (1997) Molecular characterization of specific interactions between SHP-2 phosphatase and JAK tyrosine kinases. J Biol Chem. 272(2):1032-7.
  • Kontaridis MI, et al. (2006) PTPN11 (Shp2) mutations in LEOPARD syndrome have dominant negative, not activating, effects. J Biol Chem. 281(10):6785-92.
  • Size / Price
    Catálogo: HG12318-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"