Pedido rápido

Humano PTX3/Pentraxin 3/TSG-14 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human PTX3 Información de producto de clon de cDNA
Tamaño de cDNA:1146bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens pentraxin-related gene, rapidly induced by IL-1 betaV with N terminal Flag tag.
Sinónimo de gen:TSG-14, TNFAIP5, PTX3
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano PTX3/Pentraxin 3/TSG-14 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Product nameProduct name

Pentraxin-related protein PTX3, also known as Tumor necrosis factor alpha-induced protein 5, Tumor necrosis factor-inducible gene 14 protein, TSG-14, PTX3 and TNFAIP5, is a secreted protein which contains one pentaxin domain. PTX3 plays a role in the regulation of innate resistance to pathogens, inflammatory reactions, possibly clearance of self-components and female fertility. Pentraxins are a family of evolutionarily conserved multifunctional pattern-recognition proteins characterized by a cyclic multimeric structure. Based on the primary structure of the subunit, the pentraxins are divided into two groups: short pentraxins and long pentraxins. C-reactive protein (CRP) and serum amyloid P-component (SAP) are the two short pentraxins. The prototype protein of the long pentraxin group is pentraxin 3 (PTX3). CRP and SAP are produced primarily in the liver in response to IL-6, while PTX3 is produced by a variety of tissues and cells and in particular by innate immunity cells in response to proinflammatory signals and Toll-like receptor (TLR) engagement. PTX3 is essential in female fertility by acting as a nodal point for the assembly of the cumulus oophorus hyaluronan-rich extracellular matrix. PTX3 interacts with several ligands, including growth factors, extracellular matrix components and selected pathogens, playing a role in complement activation and facilitating pathogen recognition by phagocytes, acting as a predecessor of antibodies. PTX3 may also contribute to the pathogenesis of atherosclerosis.

  • Rolph,M.S. et al., 2002, Arterioscler Thromb Vasc Biol. 22 (5):e10-4.
  • Mantovani A., et al., 2003, Vaccine. 21:S43-S47.
  • Luchetti,M.M. et al., 2004, Clin Exp Rheumatol. 22 (3):S66-72.
  • Mantovani, A. et al., 2006, Vascul Pharmacol. 45 (5):326-30.
  • Inforzato A., et al., 2008, J. Biol. Chem. 283:10147-61.
  • Size / Price
    Catálogo: HG12082-NF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.