After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano Glutaminyl cyclase / QPCT clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human QPCT Información de producto de clon de cDNA
Gene_bank_ref_id:BC047756
Tamaño de cDNA:1086bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens glutaminyl-peptide cyclotransferase with N terminal Myc tag.
Sinónimo de gen:GCT, QC, sQC, QPCT
Especie:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano Glutaminyl cyclase / QPCT clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Humano Glutaminyl cyclase / QPCT clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG13752-ACG$225
Humano Glutaminyl cyclase / QPCT clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG13752-ACR$225
Humano Glutaminyl cyclase / QPCT clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG13752-CF$195
Humano Glutaminyl cyclase / QPCT clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG13752-CH$195
Humano Glutaminyl cyclase / QPCT clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG13752-CM$195
Humano Glutaminyl cyclase / QPCT clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG13752-CY$195
Humano Glutaminyl cyclase / QPCT clonación del ADN o clonación génica(Vector de expresión)HG13752-G$75
Humano Glutaminyl cyclase / QPCT clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG13752-NF$195
Humano Glutaminyl cyclase / QPCT clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG13752-NH$195
Humano Glutaminyl cyclase / QPCT clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG13752-NM$195
Humano Glutaminyl cyclase / QPCT clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG13752-NY$195
Humano Glutaminyl cyclase / QPCT clonación del ADN o clonación génica(vector de clonación)HG13752-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Glutaminyl cyclase, also known as QPCT, can promote the N-terminal cyclization reaction of N-terminal pyroglutamate(pGlu). The pGlu formation from its glutaminyl precursor is required in the maturation of numerous bioactive peptides, while the aberrant formation of pGlu may be related to several pathological processes, such as osteoporosis and amyloidotic diseases. Glutaminyl cyclase's structure reveals an alpha/beta scaffold akin to that of two-zinc exopeptidases but with several insertions and deletions, particularly in the active-site region. Glutaminyl cyclase's amino acid sequence of this enzyme is 86% identical to that of bovine glutaminyl cyclase. It is responsible for the presence of pyroglutamyl residues in many neuroendocrine peptides.

Referencias
  • Busby WH, et al. (1987) An enzyme(s) that converts glutaminyl-peptides into pyroglutamyl-peptides. Presence in pituitary, brain, adrenal medulla, and lymphocytes. J Biol Chem. 262(18):8532-6.
  • Bateman RC, et al. (2001) Evidence for essential histidines in human pituitary glutaminyl cyclase. Biochemistry. 40(37):11246-50.
  • Schilling S, et al. (2002) Heterologous expression and characterization of human glutaminyl cyclase: evidence for a disulfide bond with importance for catalytic activity. Biochemistry. 41 (35):10849-57.
  • Size / Price
    Catálogo: HG13752-NM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"