Pedido rápido

Humano RAB39B clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

  • other Green fluorescent protein / GFP Gene Plasmid Map 5610
Hoja de datosReseñasProductos relacionadosProtocolos
Humano RAB39B Información de producto de clon de cDNA
Gene_bank_ref_id:BC009714
Tamaño de cDNA:687 bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens RAB39B, member RAS oncogene family with C terminal His tag.
Sinónimo de gen:MRX72, RAB39B
Especie:Human
Vector:pCMV3-C-His
Plasmid:pCMV3-RAB39B-His
Sitio de restricción:KpnI + XbaI(6kb+0.69kb)
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with RAB39B qPCR primers for gene expression analysis, HP102667 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano RAB39B clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano RAB39B clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14011-ACG$225
Humano RAB39B clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14011-ACR$225
Humano RAB39B clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14011-ANG$225
Humano RAB39B clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14011-ANR$225
Humano RAB39B clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14011-CF$195
Humano RAB39B clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14011-CH$195
Humano RAB39B clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14011-CM$195
Humano RAB39B clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14011-CY$195
Humano RAB39B clonación del ADN o clonación génica(Vector de expresión)HG14011-G$75
Humano RAB39B clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14011-NF$195
Humano RAB39B clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14011-NH$195
Humano RAB39B clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14011-NM$195
Humano RAB39B clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14011-NY$195
Humano RAB39B clonación del ADN o clonación génica(vector de clonación)HG14011-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG14011-CH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
DisponibilidadIn Stock
Añadir a carroBulk Discount Requiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"