Pedido rápido

Humano RAB5A clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

  • Human RAB5A ORF mammalian expression plasmid, C-His tag
Hoja de datosReseñasProductos relacionadosProtocolos
Humano RAB5A Información de producto de clon de cDNA
Gene_bank_ref_id:BC001267
Tamaño de cDNA:648bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens RAB5A, member RAS oncogene family with C terminal His tag.
Sinónimo de gen:RAB5, RAB5A
Especie:Human
Vector:pCMV3-C-His
Plasmid:pCMV3-Rab5-His
Sitio de restricción:KpnI + XbaI (6kb + 0.69kb)
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with RAB5A qPCR primers for gene expression analysis, HP102669 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano RAB5A Gene Plasmid Map
Human RAB5A ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano RAB5A clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Product nameProduct name
Size / Price
Catálogo: HG14013-CH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad
Añadir a carroBulk Discount Requiry

Datasheet & Documentation

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"