After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano RAB5A clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human RAB5A Información de producto de clon de cDNA
Gene_bank_ref_id:BC001267
Tamaño de cDNA:648bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens RAB5A, member RAS oncogene family with C terminal His tag.
Sinónimo de gen:RAB5, RAB5A
Especie:Human
Vector:pCMV3-C-His
Plasmid:pCMV3-Rab5-His
Sitio de restricción:KpnI + XbaI (6kb + 0.69kb)
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human RAB5A Gene Plasmid Map
Human RAB5A ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano RAB5A clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano RAB5A clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14013-ACG$225
Humano RAB5A clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14013-ACR$225
Humano RAB5A clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14013-ANG$225
Humano RAB5A clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14013-ANR$225
Humano RAB5A clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14013-CF$195
Humano RAB5A clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14013-CH$195
Humano RAB5A clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14013-CM$195
Humano RAB5A clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14013-CY$195
Humano RAB5A clonación del ADN o clonación génica(Vector de expresión)HG14013-G$75
Humano RAB5A clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14013-NF$195
Humano RAB5A clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14013-NH$195
Humano RAB5A clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14013-NM$195
Humano RAB5A clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14013-NY$195
Humano RAB5A clonación del ADN o clonación génica(vector de clonación)HG14013-UT$195
Humano RAB5A clonación del ADN o clonación génica(vector de clonación)HG14013-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG14013-CH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
DisponibilidadIn Stock
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
  • Human RAB5A ORF mammalian expression plasmid, C-His tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"