Pedido rápido

Humano RASSF5 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human RASSF5 Información de producto de clon de cDNA
Tamaño de cDNA:798bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens Ras association (RalGDS/AF-6) domain family member 5 with C terminal His tag.
Sinónimo de gen:RAPL, Maxp1, NORE1, NORE1A, NORE1B, RASSF3
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano RASSF5 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano RASSF5 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG15161-ACG$225
Humano RASSF5 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG15161-ACR$225
Humano RASSF5 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG15161-ANG$225
Humano RASSF5 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG15161-ANR$225
Humano RASSF5 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG15161-CF$195
Humano RASSF5 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG15161-CH$195
Humano RASSF5 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG15161-CM$195
Humano RASSF5 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG15161-CY$195
Humano RASSF5 clonación del ADN o clonación génica(Vector de expresión)HG15161-G$75
Humano RASSF5 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG15161-NF$195
Humano RASSF5 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG15161-NH$195
Humano RASSF5 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG15161-NM$195
Humano RASSF5 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG15161-NY$195
Humano RASSF5 clonación del ADN o clonación génica(vector de clonación)HG15161-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG15161-CH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.