Pedido rápido

Text Size:AAA

Humano RCN3 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human RCN3 Información de producto de clon de cDNA
Tamaño de cDNA:987bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens reticulocalbin 3, EF-hand calcium binding domain with C terminal Myc tag.
Sinónimo de gen:RLP49, RCN3
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

RCN3 belongs to the CREC family which contains multiple EF-hand Ca2+-binding proteins localized to the secretory pathway. RCN3 sequence is characterized by the presence of five Arg-Xaa-Xaa-Arg motifs, which represents the target sequence of subtilisin-like proprotein convertases(SPCs). SPCs are a family of seven structurally related serine endoproteases that are involved in the proteolytic activation of proproteins.RCN3 is transiently associated with proPACE4, but not with mature PACE4. Inhibition of PACE4 maturation by a Ca2+ ionophore resulted in accumulation of the proPACE4-RCN-3 complex in cells. It has been proposed that elective and transient association of RCN3 with the precursor of PACE4 plays an important role in the biosynthesis of PACE4.

  • Danielsen JM, et al. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.
  • Rual JF, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):1173-8.
  • Kamatani Y, et al. (2010) Genome-wide association study of hematological and biochemical traits in a Japanese population. Nat Genet. 42(3):210-5.
  • Size / Price
    Catálogo: HG13533-CM
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.