Pedido rápido

Humano REG3G clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human REG3G Información de producto de clon de cDNA
Tamaño de cDNA:528bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens lumican with C terminal Flag tag.
Sinónimo de gen:PAP1B, PAPIB, UNQ429, REG-III, MGC118998, MGC118999, MGC119001, REG3G
Sitio de restricción:KpnI + XbaI (6kb + 0.57kb)
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 297T/C not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human REG3G Gene Plasmid Map
Human REG3G ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Regenerating gene (Reg), first isolated from a regenerating islet cDNA library, encodes a secretory protein with a growth stimulating effect on pancreatic beta cells. Reg and Reg-related genes which were expressed in various organs have been revealed to constitute a multigene family, the Reg family, which consists of four subtypes (types I, II, III, IV) based on the primary structures of the encoded proteins of the genes, which are associated with tissue repair and have been directly implicated in pancreatic beta-cell regeneration. Reg proteins are expressed in various organs and are involved in cancers and neurodegenerative diseases. They display a typical C-type lectin-like domain but possess additional highly conserved amino acids. Regenerating islet-derived 3 gamma (REG3G), also known as pancreatitis-associated protein 1B (PAP1B), is a member of the secreted Reg superfamily and contains one typical C-type lectin domain. REG3G is expressed weakly in pancreas, strongly in intestinal tract, but not in hyperplastic islets REG3G might be a stress protein involved in the control of bacterial proliferation. It was indicated that REG3G specifically targets Gram-positive bacteria because it binds to their surface peptidoglycan layer, and serves as one of several antimicrobial peptides produced by paneth cells via stimulation of toll-like receptors (TLRs) by pathogen-associated molecular patterns (PAMPs).

  • Narushima Y, et al. (1997) Structure, chromosomal localization and expression of mouse genes encoding type III Reg, RegIII alpha, RegIII beta, RegIII gamma. Gene. 185(2): 159-68.
  • Nata K, et al. (2004) Molecular cloning, expression and chromosomal localization of a novel human REG family gene, REG III. Gene. 340(1): 161-70.
  • Laurine E, et al. (2005) PAP IB, a new member of the Reg gene family: cloning, expression, structural properties, and evolution by gene duplication. Biochim Biophys Acta. 1727(3): 177-87.
  • Castellarin ML, et al. (2007) The identification and sequence analysis of a new Reg3gamma and Reg2 in the Syrian golden hamster. Biochim Biophys Acta. 1769(9-10): 579-85.
  • Size / Price
    Catálogo: HG11641-CF
    Precio de lista: 
    Precio:      (You Save: )
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.