After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano RELA / Transcription factor p65 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human RELA Información de producto de clon de cDNA
Gene_bank_ref_id:NM_021975
Tamaño de cDNA:1656bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens v-rel reticuloendotheliosis viral oncogene homolog A (avian) with C terminal His tag.
Sinónimo de gen:p65
Especie:Human
Vector:pCMV3-C-His
Plasmid:pCMV3-RELA-His
Sitio de restricción:KpnI + XbaI (6kb + 1.7kb)
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human RELA Gene Plasmid Map
Human RELA / Transcription factor p65 / NFkB p65 ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano RELA / Transcription factor p65 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano RELA / Transcription factor p65 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG12054-ACG$245
Humano RELA / Transcription factor p65 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG12054-ACR$245
Humano RELA / Transcription factor p65 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG12054-ANG$245
Humano RELA / Transcription factor p65 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG12054-ANR$245
Humano RELA / Transcription factor p65 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG12054-CF$215
Humano RELA / Transcription factor p65 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG12054-CH$215
Humano RELA / Transcription factor p65 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG12054-CM$215
Humano RELA / Transcription factor p65 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG12054-CY$215
Humano RELA / Transcription factor p65 clonación del ADN o clonación génica(Vector de expresión)HG12054-G$75
Humano RELA / Transcription factor p65 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG12054-NF$215
Humano RELA / Transcription factor p65 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG12054-NH$215
Humano RELA / Transcription factor p65 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG12054-NM$215
Humano RELA / Transcription factor p65 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG12054-NY$215
Humano RELA / Transcription factor p65 clonación del ADN o clonación génica(vector de clonación)HG12054-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

RELA (v-rel reticuloendotheliosis viral oncogene homolog A), also known as Nuclear factor NF-kappa-B p65 subunit, or Transcription factor p65, is a transcription factor expressed in growth plate chondrocytes where it facilitates chondrogenesis. The v-rel avian reticuloendotheliosis viral oncogene homolog A (RELA) gene encodes the major component of the NF-?B complex. NF-kappaB is a generic name for an evolutionarily conserved transcription-factor system that contributes to the mounting of an effective immune response but is also involved in the regulation of cell proliferation, development, and apoptosis. The implication of NF-kappaB in central biological processes and its extraordinary connectivity to other signaling pathways raise a need for highly controlled regulation of NF-kappaB activity at several levels. The mammalian Rel/NF-kappaB family of transcription factors, including RelA, c-Rel, RelB, NF-kappaB1 (p50 and its precursor p105), and NF-kappaB2 (p52 and its precursor p100), plays a central role in the immune system by regulating several processes ranging from the development and survival of lymphocytes and lymphoid organs to the control of immune responses and malignant transformation.

Referencias
  • Hashimoto R, et al. (2011) Variants of the RELA gene are associated with schizophrenia and their startle responses. Neuropsychopharmacology. 36(9): 1921-31.
  • Vallabhapurapu S, et al. (2009) Regulation and function of NF-kappaB transcription factors in the immune system. Annu Rev Immunol. 27: 693-733.
  • Schmitz ML, et al. (2004) NF-kappaB: a multifaceted transcription factor regulated at several levels. Chembiochem. 5(10): 1348-58.
  • Size / Price
    Catálogo: HG12054-CH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
    • Human RELA / Transcription factor p65 / NFkB p65 ORF mammalian expression plasmid, C-His tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"