After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano RGMA clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human RGMA Información de producto de clon de cDNA
Tamaño de cDNA:1227bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens RGM domain family, member A with N terminal HA tag.
Sinónimo de gen:RGM
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

RGMa, also known as RGM domain family, member A, belongs to the RGM (repulsive guidance molecule) family whose members are membrane-associated glycoprotein. RGMa is a glycosylphosphatidylinositol-anchored glycoprotein that functions as an axon guidance protein in the developing and adult central nervous system. It helps guide Retinal Ganglion Cell (RGC) axons to the tectum in the midbrain. RGMa has been implicated to play an important role in the developing brain and in the scar tissue that forms after a brain injury. This protein may also function as a tumor suppressor in some cancers.

  • Severyn CJ, et al. (2009). Molecular biology, genetics and biochemistry of the repulsive guidance molecule family. Biochem J. 422 (3): 393-403.
  • Monnier PP, et al. (2002) RGM is a repulsive guidance molecule for retinal axons. Nature. 419: 392-5.
  • Matsunaga E, et al. (2004) RGM and its receptor neogenin regulate neuronal survival. Nature Cell Biology. 6: 749-55.
  • Size / Price
    Catálogo: HG12086-NY
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.